Help

Usage notes, input formats, interpretation of outputs, and troubleshooting across all tools.
Jump to content

Quick start

  1. Open a tool from the menu (e.g., Primer Design, KASP, In silico PCR).
  2. Provide input:
    • Paste sequences in FASTA format, or
    • Upload a FASTA file, or
    • Retrieve sequence by an accession/variant ID (where supported).
  3. Adjust parameters (primer length, Tm, product size, assay options).
  4. Click Generate. Results appear in the bottom output tabs (copy/paste to Excel when needed).

Input formats

FASTA

Use standard FASTA with a header line starting with > and one or more lines of sequence:

>Seq1
ACGTTGCAACGTTGCAACGTTGCA
>Seq2
TTTACCGGAACTGACTGACT

Allowed nucleotide codes

Standard and degenerate bases are accepted using IUB/IUPAC codes. Common examples:

  • N=A/C/G/T, R=A/G, Y=C/T, S=G/C, W=A/T
  • K=G/T, M=A/C, B=C/G/T, D=A/G/T, H=A/C/T, V=A/C/G
  • U=Uracil, I=Inosine
Note on modified bases
Some tools support additional internal codes for LNA nucleotides (e.g., E=LNA-dA, F=LNA-dC, J=LNA-dG, L=LNA-dT). Use these only where explicitly documented on the tool page.

Targeting markup inside sequences

Several tools allow you to constrain primer placement directly inside the sequence by adding markup.

Primer targeting brackets

Square brackets ([, ]) can mark regions where primer binding or variants should be evaluated.

...ACCTG [A/T] GGTCA...
Excluded regions

Use /.../ to exclude regions from primer placement (can be repeated multiple times).

...ACCTG /REPEAT/ GGTCA...

Exact interpretation depends on the specific tool. When in doubt, keep the input unmarked and use parameter filters.

PCR primer design

Applies to: PCR / Multiplex / qPCR / RPA

  • Primer length and Tm range: define the design window; keep primer pairs within a narrow Tm interval for multiplex.
  • Product size range: match the downstream method (e.g., short for qPCR/RPA; longer for Sanger).
  • Minimal linguistic complexity: helps avoid low-complexity / repetitive regions and reduces spurious priming.
  • Non-specific priming control: enable to reduce off-target binding in repetitive genomes.

  • Multiplex PCR: favors primer sets with reduced cross-dimers; use tighter Tm bounds.
  • TaqMan / MGB probe assays: enable one option at a time; probes are designed within the amplicon under assay-specific constraints.
  • RPA: shifts to longer primers and short amplicons suitable for ~37–42 °C isothermal workflows.
  • Inverse PCR: assume circular template; ensure the marked region is consistent with circular amplification logic.
  • C>>T bisulfite conversion: converts non-CpG cytosines for in silico evaluation on bisulfite-treated sequences.
  • Overlapping primers: relaxes constraints on overlap where necessary (use cautiously).

If you need universal tails/adapters, provide sequences in the Forward primer tail and/or Reverse primer tail fields. The tool reports final primers including tails.

Tip: keep tails outside the melting calculation used for annealing (depends on your protocol); validate in the lab.

Genotyping (KASP / AS-PCR)

Applies to: KASP primers assay design

  • Place the target variant inside square brackets, for example [A/T] (bi-allelic), or multi-allelic forms.
  • Alternatively, use an IUPAC ambiguity code inside brackets (e.g., [R]).
  • Keep flanking regions long enough to allow design of allele-specific primers away from problematic local repeats.

If supported on the page, you can retrieve flanking sequence around a list of rsIDs by providing:

  • Species (e.g., homo_sapiens, arabidopsis_thaliana)
  • rsIDs (space/comma separated)
  • Flank size (± bases)

If the page provides a tails list panel, enter standard (or custom) tails in FASTA-like format, for example:

>FAM
GAAGGTGACCAAGTTCATGCT
>HEX
GAAGGTCGGAGTCAACGGATT

In silico PCR

Applies to: In silico PCR

  • Searches for primer/probe (or gRNA/miRNA-like) binding sites across the provided sequences.
  • Predicts likely amplicons within configured product-size constraints.
  • Reports mismatches and provides a log of hits/off-targets (depending on settings).

  1. Paste/upload target sequences in FASTA.
  2. Provide primer/probe list (if the page includes a dedicated tab for it).
  3. Run analysis and review both Results and Log output tabs.
  4. If you see no output, confirm that the tool produced hits within the allowed product size range, and verify primer orientation (forward/reverse).

LAMP primer design

Applies to: LAMP primer sets design tool

  1. Paste/upload target sequence in FASTA (or retrieve by NCBI accession where available).
  2. Set primer constraints (length, Tm, minimal linguistic complexity) and maximum F2–B2 amplicon size.
  3. Enable Loop Primer Design for faster amplification (LF/LB), unless you intentionally design only the core set.
  4. Click Generate and review both output tabs: Primer list and LAMP primer sets.

  • Use [ ... ] to constrain primer design to a specific region.
  • Use / ... / to exclude regions (e.g., repeats) from primer placement; can be repeated multiple times.

Multiplex tiling PCR panel design

Applies to: Custom multiplex tiling PCR panel design tool

  • Splits a target region into overlapping amplicons (tiling) and designs primers for sequencing panels.
  • Generates two complementary pools (Panel A and Panel B) to reduce primer competition across adjacent amplicons.
  • Reports primer lists and ready-to-use panel mixes for multiplex PCR workflows.

  • Target sequence(s) in FASTA. For best performance, keep each target < ~1 Mb.
  • Amplicon size range: choose by platform (e.g., shorter for Illumina; longer for ONT).
  • Gap between amplicons: set to 0 for full coverage; increase if you want fewer primers.
  • Optional pre-designed primers/probes: provide a list if you want compatibility with existing assays.

Exporting results

  • For tables in <textarea> outputs: click inside, then Ctrl+A (select all) → Ctrl+C (copy) → paste into Excel/Sheets.
  • If a tool produces multiple outputs (e.g., primer list and primer pairs), switch output tabs before copying.
  • When pasting into spreadsheets, use “Split text to columns” if a fixed delimiter is used (space or tab).

Troubleshooting

  • Verify that you clicked Generate and that output is shown in the correct result tab.
  • Reduce constraints (e.g., widen Tm range by 1–2 °C; allow slightly longer/shorter primers) and try again.
  • Confirm the sequence contains valid characters only (A/C/G/T and allowed degenerate codes); remove spaces or non-ASCII characters.
  • Open the browser console (F12 → Console) and check for JavaScript errors if the UI becomes unresponsive.

If the page interface suddenly stops working after you updated files on the server (for example, buttons do nothing, tabs do not switch, or results are not displayed), the most common reason is that the browser is still using an old cached JavaScript file.

Hard reload
  • Windows/Linux: Ctrl+F5 or Ctrl+Shift+R
  • macOS: Cmd+Shift+R
Chrome / Edge (strongest option)
  1. Press F12 to open DevTools
  2. Right-click the reload button → Empty cache and hard reload
If the problem persists
  • Clear site data for this domain (cookies + cache), then reload.
  • In DevTools → Network: check Disable cache (while DevTools is open) and reload.
  • Check the Console (DevTools → Console) for JavaScript errors and fix the first error in the stack.
Recommended server-side fix (prevents recurrence)
Add versioned URLs for scripts and CSS (cache-busting), e.g. ../js/panel.js?v=20260106. After every deployment, update the version string once (date or build number). This ensures users always load the correct JavaScript version.

  • Confirm the ID is correct (e.g., NCBI nucleotide accession like A02710; rsIDs like rs4988235).
  • Network policies (institutional firewall) may block external API calls; use manual FASTA upload in such environments.
  • Try again later if the upstream service is rate-limiting or temporarily unavailable.

  • Enable Non-specific priming control and increase minimal complexity.
  • Avoid designing across low-complexity segments; consider marking exclusion regions with /.../ if the tool supports it.
  • For multiplex panels: tighten primer Tm window and reduce allowed cross-dimers (if available).

Data & privacy

  • Most computations are performed locally in your browser (client-side JavaScript), based on the sequence you paste or upload.
  • Optional retrieval functions (NCBI/Ensembl) send requests to external services only when you click “Retrieve”.
  • If you work with sensitive sequences, prefer manual FASTA upload and use an offline/local version of the tools where applicable.