Help

• Multiplex PCR: favors primer sets with reduced cross-dimers; use tighter Tm bounds.
• TaqMan / MGB probe assays: enable one option at a time; probes are designed within the amplicon under assay-specific constraints.
• RPA: shifts to longer primers and short amplicons suitable for ~37–42 °C isothermal workflows.
• Inverse PCR: assume circular template; ensure the marked region is consistent with circular amplification logic.
• C>>T bisulfite conversion: converts non-CpG cytosines for in silico evaluation on bisulfite-treated sequences.
• Overlapping primers: relaxes constraints on overlap where necessary (use cautiously).

Sequences are expected to be represented in the standard IUB/IUPAC nucleic acid codes. Acceptable letters:

The structure of the last nucleotides at the 3′-end of the primer can be specified to control primer specificity:

• N — any pattern (no constraint)
• One, two, or more characters using standard or mixed letters
• Multiple patterns of equal length separated by spaces: sws ssw sww wss www

For example, WSS corresponds to all 3′-end variants: acc acg agc agg tcc tcg tgc tgg.

The pre-designed primers/probes list is used for multiplexing with prior designed PCR primer/probe sets. This allows you to incorporate existing validated assays into new multiplex panels while ensuring compatibility and avoiding cross-reactivity.

Design of specific PCR primers for in silico bisulfite conversion for both strands. Only cytosines not followed by guanine (non-CpG context) will be replaced by thymines. CpG methylation sites are preserved.

Optimal primers should hybridize only to the target sequence. Common problems include annealing to repetitive sequences (retrotransposons, transposons, inverted tandem repeats), alternative product amplification, and multiple bands due to off-target binding.

Minor Groove Binders (MGBs) selectively bind non-covalently to the minor groove of the DNA helix, enabling shorter probe lengths and superior quenching for highly specific TaqMan-type assays.

>1
gctctctgtgtctgatccaagaggcgaggccagtttcatttgagcattaa[A/G]tgtcaagttctgcacgctatcatcagggg

>2
tcatattccagtttgggcgagttttaagataggtccgg[S]acagtctttgcggcgccaacgcgtctttctccag

[S] represents G/C using the IUPAC ambiguity code.

Leave one side empty for deletions:

>1
tcatattccagtttgggcgagttttaagataggtccgg[AG/]acagtctttgcggcgccaac

>1
tgggcagcattagtagaagaaagtacaagaccgtgtgtagagg[GATATACTTGAG/CAGTCC]agcagatagcgttggatag

The [square brackets] should surround all SNPs that are part of the haplotype. Nearby SNPs not part of the haplotype should be outside brackets and identified using an IUPAC code.

ASP primers can carry standard KASP FAM and HEX tails (LGC Biosearch Technologies). Paste tails in FASTA-like format in the dedicated tab:

>FAM
GAAGGTGACCAAGTTCATGCT
>HEX
GAAGGTCGGAGTCAACGGATT

Custom tails can be used instead of the standard sequences.

Enter one or more rsIDs (space/comma separated), select a species, and set the desired flank size. The tool retrieves the flanking sequence from Ensembl and populates the input area automatically. For human variants, a direct retrieval from NCBI is also available via kasp2.html.

• Biallelic SNP: flank [A/G] flank or single IUPAC code flank [R] flank
• Tri- / tetra-allelic SNP: [A/C/G], [A/C/G/T] or [N]
• Insertion / deletion: use - for the empty side, e.g. [ATCG/-] (4-bp deletion) or [-/T] (single-base insertion)
• Excluded region: / .../ — primers will not be placed inside the slashes (useful for masking known repeats inside a long flank)

>rs1801133
tggggggaaaattagaggtaaccaaaatgggg...gatgaaatcg[Y]ctcccgcagacaccttctcc...

>rs3918290
gccacatacagtgaaaaccaactcaataaa...aatcacactta[ATCG/-]gttgtctggaaagtcagcc...

All standard IUPAC ambiguity codes are accepted both inside and outside the brackets — see the Input formats section.

Exactly one probe format may be active at a time — checking one option automatically clears the others.

• Length range (nt) — default 20–22. Keep the window narrow for uniform amplification across loci.
• Tm range (°C) — default 61–63. Match it to your master-mix recommendation. Probe Tm is internally targeted ~5–10 °C above primer Tm.
• PCR product size (bp) — default 200–500. For optimal qPCR efficiency keep amplicons ≤200 bp where possible.
• 3′-end pattern (default sws ssw sww wss www) — restricts the last bases of each primer; use S=G/C, W=A/T, N=any. Multiple space-separated patterns are tried and the best result is kept.
• Forward / Reverse tail (5′-3′) — optional universal tails appended to the 5′ end of each primer (e.g. M13 sequences) for downstream universal-primer detection.
• Mask repeats & low-complexity regions (on by default) — excludes degenerate regions from primer placement; see TotalRepeats.
• Allow overlapping primer positions — relaxes positional constraints when the search space is tight (use cautiously).
• C → T bisulfite conversion — switches the design into bisulfite-treated mode for methylation analysis (non-CpG cytosines are converted in silico; CpG sites preserved).

• Input Sequences — your FASTA / retrieved sequences with live formatting and a per-tab counter.
• My Primers — paste pre-existing primers/probes (optional) to be checked for compatibility with newly designed sets, e.g. for adding the new variant to an existing multiplex panel.
• Report (Primer list) — flat list of every primer and probe candidate with their physico-chemical properties.
• qPCR Assay Sets — final ready-to-order assays grouped by target: forward primer + reverse primer + allele-discriminating probe.

Per-oligo columns

ID · Sequence · Length · Tm · CG% · LC% · YR%

Per-pair columns (additional)

Fragment size (bp) · Annealing Tm (°C)

LC% and YR% are described under PCR primer design → Linguistic sequence complexity.

1. Load the variant — paste FASTA with [REF/ALT], upload a file, or retrieve by rsID from Ensembl. Use Load Example to see the expected formatting.
2. Pick a probe format (TaqMan by default; switch to MGB for short / AT-rich targets, or Molecular beacon for difficult discrimination).
3. Adjust Tm range, product size and 3′-end pattern if your master-mix or chemistry requires it.
4. (Optional) Paste universal forward/reverse tails or pre-existing primers in My Primers.
5. Click Generate. Review the assay sets in the qPCR Assay Sets tab.
6. Copy the result area (Ctrl+A → Ctrl+C) and paste into Excel for ordering — see Exporting results.

• No assay set returned — widen the Tm window (e.g. 60–64 °C), increase the maximum product size, or temporarily uncheck Mask repeats to confirm a set can be generated.
• Probe not designed — for AT-rich variants switch to MGB; for very low-complexity flanks try Molecular beacon; check that the polymorphic position has at least 30 bp of unique flanking sequence on each side.
• Ensembl retrieval fails — confirm the rsID and species id are correct, see Sequence retrieval fails.
• Adding the assay to an existing panel — paste the existing primer/probe set into My Primers; new candidates incompatible with the panel will be filtered out.

Paste a multi-FASTA where each sequence contains one SNP marked in square brackets. Provide ~150–300 nt of flanking context on each side so the tool has room to choose PCR primers and probes.

• Biallelic SNP: ...flank[C/T]flank...
• Multi-allelic: ...flank[G/A/C/T]flank...
• IUPAC shorthand: ...flank[R]flank... (R=A/G, Y=C/T, S=G/C, W=A/T, K=G/T, M=A/C)
• InDels: ...flank[ATCG/-]flank... (one allele empty for a pure deletion)
• Excluded region: wrap with forward slashes / ... / — both PCR primers and SBE probes will avoid it (use for repeats, low-complexity tracts, or known nearby variants).

>rs3918290
gccacatacagtgaaaaccaactcaataa…ttagatgttaaatcacactta[C/A]gttgtctggaaagtcagcc…aatatacat
>rs1801133
tggggggaaaattagaggtaaccaaaatgg…aagaatgtgtcagcctcaaagaaaagctgcgtgatgatgaaatcg[Y]ctcccgcagacaccttctcc…ggaggtggctcagag

Sequences can also be retrieved by rsID via Ensembl directly from the input tab.

• Length range (default 20–22 nt) and Tm range (default 61–63 °C). Tight Tm windows are essential for multiplex — all loci must amplify under one cycling profile.
• PCR product size (default 200–500 bp). For SNaPshot it is the SBE probe — not the amplicon — that resolves the genotype, so the amplicon can be small.
• 3′-end pattern (default sws ssw sww wss www): a space-separated list of 3-letter composition codes (S=G/C, W=A/T, N=any) describing the last three bases. The tool tries every pattern and keeps the best primer; the default favours one G/C clamp without G/C runs.
• Forward / Reverse primer 5′-tails (e.g. M13 universal sequences): added to the 5′ end of every primer for compatibility with downstream sequencing or universal-tail PCR strategies. Leave empty if no tail is required.
• Mask repeats & low-complexity regions: avoids placing primers/probes in tandem repeats or simple-sequence tracts.
• Allow overlapping primer positions: returns multiple alternative primers covering the same window. Useful for finding workable candidates in difficult templates.

A pre-existing primer list (My Primers tab) is checked against every newly designed primer — any new primer that would form a heterodimer with one of yours is rejected.

An SBE probe has its 3′-end fixed one nucleotide before the SNP on the PCR amplicon. After the SAP/ExoI clean-up, the probe is extended by a single fluorescent ddNTP whose colour identifies the allele. The tool generates the probe in both orientations (forward and reverse) and you choose the one with the better local context (no nearby secondary SNPs, balanced Tm, no homopolymer at the 3′-end).

• Probe core length 16–35 nt with the same Tm window as the PCR primers, so the SBE step works under the standard SNaPshot cycling profile.
• Length staggering for CE: probes are sorted by core length and a 5′-tail is appended so adjacent probes differ by ≥4 nt in total length (the typical CE peak resolution limit). The shortest probe gets no tail; the next gets just enough tail to be 4 nt longer; and so on.
• Tail composition: by default the tail is poly-T. If you fill in Forward primer tail / Reverse primer tail, those sequences are also reused as the SBE-probe tail (cycled if shorter than required). Tails are printed in UPPERCASE to visually separate them from the lowercase probe core, e.g. TTTCACacgtacgtacgtacgtac.
• Mobility caveat: tail composition affects CE mobility almost as much as length. Pure poly-dT is the safest baseline; mixed-composition tails (e.g. dGACT) shift mobility differently and may compress two adjacent probes into one peak. If using a non-poly-T tail, increase the minimum length gap or run a CE pre-test on the panel.
• The tool does not account for the 1-nt extension and dye-induced mobility shift after SBE (typically 1–2 nt depending on dye/ddNTP). For very dense panels, add a 1–2 nt safety buffer to the staggering.

The full panel-level SBE probe table appears in the Multiplex Assay Sets tab under the heading === SBE probe panel ===.

Multiplex compatibility is enforced at design time, not as a post-hoc filter. As primers are designed locus-by-locus, every new candidate is checked against the cumulative pool of all previously accepted primers from every other locus. Any primer that would form a heterodimer with an already-accepted primer is rejected and an alternative is chosen.

• For each locus you may see one or several PCR primer pairs in the Multiplex Assay Sets tab.
• Any forward + reverse pair from one locus can be freely combined with any pair from any other locus in a single mPCR. All listed pairs are pre-validated to be cross-locus dimer-free.
• This lets you choose, per locus, the pair with the best Tm match, smallest amplicon, or highest specificity, without re-checking compatibility against the rest of the panel.

Note: cross-locus compatibility is enforced for the PCR primers. The SBE step uses different chemistry and is run after SAP/ExoI removes excess PCR primers and dNTPs, so probe-vs-PCR-primer interactions are not the limiting factor in practice.

Two output tabs serve different purposes:

• Report (Primer list) — every candidate primer and probe found per locus, with full quality metrics. Use this to inspect alternatives or to debug a locus that produced no multiplex set.
• Multiplex Assay Sets — only the validated PCR primer pairs (cross-locus dimer-free) plus the panel-level SBE probe table with length-staggering tails. This is the orderable output.

Column headers in both tabs are tab-separated and Excel-friendly:

ID    Sequence(5'-3')    Length    Tm(°C)    CG(%)    LC(%)    YR(%)    Fragment_Size(bp)/Tm(°C)

• LC% (linguistic complexity) penalises repeats and homopolymers — values ≥70% are recommended for primers.
• YR% reports purine/pyrimidine balance — extremes can predispose to secondary structure.
• Fragment size / Annealing Tm is shown on the reverse-primer row of each PCR pair: the predicted amplicon size in bp and a Tm estimate of the full amplicon (informational, not the cycling Tm).
• Probe ID encodes locus and orientation, e.g. 1F_… = locus 1, forward probe.

When C→T bisulfite conversion is enabled, the input sequence is first virtually converted (every unmethylated C becomes T on each strand independently), and primers/probes are designed against the converted sequence. This is the standard preparation for bisulfite-sequencing assays where the methylation status at a CpG site is read out as a C/T polymorphism after conversion.

• Mark the CpG of interest with [C/T] in the original (unconverted) sequence — this represents methylated vs unmethylated allele after conversion.
• Avoid placing PCR primers over additional CpG sites whenever possible (the tool does not do this automatically — use /.../ markup if needed).
• The two strands diverge after conversion, so the forward and reverse SBE probes are designed independently on each converted strand.

1. Multiplex PCR — pool all forward and reverse primers from the chosen pairs at equal final concentration (typically 0.05–0.2 µM each). Use a hot-start polymerase and the Tm window reported by the tool as the annealing temperature.
2. SAP/ExoI clean-up — remove unincorporated dNTPs and excess primers (Shrimp Alkaline Phosphatase + Exonuclease I). This is mandatory before the SBE step.
3. SBE reaction — combine the cleaned PCR product with the pooled SBE probes and the SNaPshot reaction mix (contains the four fluorescent ddNTPs and a thermostable polymerase). Cycle per the manufacturer's protocol.
4. Post-extension SAP — dephosphorylate unincorporated fluorescent ddNTPs (otherwise they appear as dye blobs on the trace).
5. Capillary electrophoresis — run with a size standard (e.g. GeneScan 120 LIZ) and analyse with GeneMapper or comparable software. Each locus appears as a coloured peak at the expected probe length.

If two adjacent loci share a peak position in the trace, increase the length-stagger gap or swap one probe to the opposite orientation.

1. Paste/upload target sequences in FASTA.
2. Provide the primer/probe list in the dedicated tab.
3. Run analysis and review both Results and Log output tabs.
4. If no output: confirm hits exist within the allowed product size range, and verify primer orientation (forward/reverse).

• Use [ ... ] to constrain primer design to a specific region.
• Use / ... / to exclude regions (e.g., repeats) from primer placement; can be repeated.

Enabling C→T bisulfite conversion automatically adjusts the default length (17–28 nt), Tm (57–59°C), and overlapping primer settings — suitable for designing LAMP primers on bisulfite-converted templates for methylation analysis.

• Sequences must be in FASTA format, listed in the desired assembly order.
• Adjacent fragments must share an overlap of ≥20 bp with a Tm ≥50°C to ensure efficient exonuclease digestion and annealing.
• For circular constructs, include vector (backbone) sequence at both the first and last positions. The tool will automatically generate primers spanning the junction.
• Fragment names (FASTA headers) are used in the output to label each primer pair — use meaningful names.

• Length range: annealing part of the primer (not including the overlap tail). Default 18–23 nt.
• Tm range: controls the melting temperature of the annealing portion of each primer. Default 60–62°C.
• Min. linguistic complexity (%): avoids low-complexity or repetitive primer sequences.
• 3′-end pattern: use N for any nucleotide, or specify patterns like WSS to ensure a strong 3′ terminus.

• Report (Primer list): all designed primers with name, sequence, length, Tm, GC%, and LC% values.
• PCR primer pairs: grouped by fragment, showing the forward and reverse primer for each PCR reaction needed to amplify the assembly inserts with their overlap tails.
• Overlap tails are shown in lowercase (or visually distinguished) in the primer sequences; the annealing portion is in uppercase.

• Target sequence(s) in FASTA. Mark the region with [ and ]; exclude problem areas with /.../.
• Amplicon size range: choose by platform (e.g., shorter for Illumina; longer for ONT).
• Gap between amplicons: set to 0 for full coverage; increase for fewer primers.
• Optional pre-designed primers: provide a list for compatibility with existing assays.

• Pick any region within the insert except the Inverted Terminal Repeats (ITRs).
• For genome integrity assessment, target the ends of the insert, e.g., the CMV enhancer at one end and SV-40 at the other.
• Use [ … ] directly inside the pasted sequence to pin each probe's location individually.
• Use /…/ to exclude problematic regions (repetitive elements, secondary structure hotspots) from probe placement; can be repeated multiple times.

• Probe length (35–40 nt): length of each individual oligo probe.
• Probes distance (>5 nt): minimum gap (in nucleotides) separating the two probes along the target strand. The tool also reports pairs at the configured separation.
• Calculated energy: probe self-folding energy should be above −10 kcal/mol to minimize homo- and hetero-dimer formation.
• Linguistic Complexity (LC%): measures sequence vocabulary richness; 100% = maximum diversity. Higher values reduce non-specific hybridization risk.

• Paste or upload sequences in FASTA format; name is optional but recommended (e.g., >EGFP).
• Retrieve a sequence directly from NCBI by entering a nucleotide accession ID (e.g., A02710) and clicking Retrieve Sequence.
• The name and sequence string can be separated by either a space or a tab; style must be consistent for all entries.
• Input is case-insensitive; only standard IUPAC nucleic acid characters are accepted.

• Results are reported as FWD (forward strand, positive strand) and RVS (reverse strand, negative strand) probe pairs in separate tabs.
• Pairs are presented in ranked order; test several top-ranked pairs to determine the most optimal one experimentally.
• Submit the final probe sequences to an oligo manufacturer (e.g., Eurogentec, LGC Biosearch Technologies, Eurofins) with the appropriate fluorescein and biotin modifications specified.

• Paste a single oligo sequence (5′→3′) with or without a FASTA name header.
• Standard IUB/IUPAC degenerate codes are supported (N, R, Y, S, W, K, M, B, D, H, V).
• U = Uracil (RNA), I = Inosine.
• LNA codes: E=LNA-dA, F=LNA-dC, J=LNA-dG, L=LNA-dT.
• Tm calculations use nearest-neighbor thermodynamic parameters, accounting for primer concentration, salt, and Mg²⁺.

Three calculators are available:

• Dilution: calculate stock volume needed to reach a target working concentration and volume.
• Resuspension: calculate how much TE/water to add to a lyophilised oligo to reach a desired stock concentration.
• Amount from OD/mass/nmol: inter-convert between OD₂₆₀, mass (µg), and nanomoles using the oligo's extinction coefficient and molecular weight.

• Primer concentration (0.01–5 µM): concentration of the oligo used in your reaction.
• Total salt concentration (Na⁺, K⁺, NH₄⁺, Tris⁺; 1–1000 mM): matches your buffer conditions.
• Mg²⁺ concentration (0–10 mM): free magnesium concentration in your reaction.
• Dimer sensitivity (1–10): controls the detection threshold for self-dimer reporting.

• Features: tabular summary — Tm, GC%, LC%, length, base composition, Mw, extinction coefficient, OD values — one row per primer.
• Dimers: self-dimer and cross-dimer analysis for all primer combinations, ranked by binding strength.

PrimersList handles specialized oligonucleotide types:

• Molecular beacons — stem-loop probes; the stem sequence lowers the apparent Tm and affects dimer analysis.
• Scorpion primers — self-probing amplification primers with an internal probe region.
• Standard degenerate primers, RNA oligonucleotides (U), and LNA-modified sequences (E/F/J/L).

The tool automatically detects and corrects sequence orientation (forward vs. reverse-complement) before alignment. This is especially useful when working with Sanger sequencing reads or assembly contigs that may be reported in either direction. Corrected orientations are flagged in the output.

• Visual: colour-coded alignment shown directly in the browser for quick inspection.
• FASTA: aligned sequences with gap characters (-), suitable for downstream phylogenetic or variant analysis.
• CLUSTAL: standard interleaved CLUSTAL format compatible with most alignment viewers.

1. Paste or upload one or more sequences in FASTA format.
2. Select the repeat types to detect and set minimum repeat unit / copy number thresholds.
3. Click Analyze. Results are reported per sequence with coordinates and consensus repeat units.
4. Use the masking output to generate a repeat-masked FASTA for primer design tools (paste it into PCR / LAMP / KASP tool inputs).

Repeat-rich regions are a major source of primer design failures. The recommended workflow is:

1. Run TotalRepeats on your target sequence to identify repeat coordinates.
2. Export the masked sequence (repeat regions in lower case) or manually add /…/ exclusion markup around identified repeat coordinates.
3. Paste the masked/marked sequence into the PCR, KASP, LAMP, or Assembly tool for repeat-aware primer design.

The browser-based tool is suitable for sequences up to 100 Mb. For whole-genome analyses, use the command-line TotalRepeats Java application, which supports unlimited input size.

All reagent labels and concentrations are editable. Available slots include:

• PCR buffer (label editable)
• MgCl₂ or MgSO₄ (mM)
• dNTP mix (mM)
• Forward and reverse primers (µM) — or FIP/BIP for LAMP
• Up to 4 additional probes or primers (e.g., F3/B3, loop primers for LAMP)
• An extra component slot with a custom unit label (e.g., Betaine, enzyme enhancer)
• DMSO (%), ROX reference dye (×), SYBR Green II (×)
• Primary polymerase (U/µl) and optional secondary Pfu polymerase (U/µl)
• DNA template volume (µl)

• Set a final concentration of 0 for any component you do not need — it will be excluded from the output.
• Include a 5–10% overage by entering a slightly higher number of reactions (e.g., 11 instead of 10) to account for pipetting losses.
• For LAMP, the preset loads the full 6-primer set (FIP, BIP, F3, B3, FLOOP, BLOOP) with recommended concentrations and isothermal buffer.
• Export the result table with Ctrl+A → Ctrl+C → paste into Excel or your lab notebook.

• Units must be consistent across all concentration fields (all in mM, all in %, etc.) and across all volume fields (all in mL, µl, etc.).
• pH mixing uses a linear approximation (C₁·V₁ + C₂·V₂ = C_f·V_f), valid only for rough educational estimates; true pH requires accounting for buffer capacity and activity coefficients.
• The tool assumes ideal mixing (volumes are additive). In practice, some solutions (e.g., concentrated sulfuric acid) show significant volume changes on mixing.
• The formula applied is the standard mixing equation: C₁V₁ + C₂V₂ = CfVf.

• Reduce the probe distance parameter if the target region is short — a very large required gap can exhaust available candidates.
• Confirm the input sequence is long enough: two non-overlapping 35–40 nt probes plus the required distance gap requires at least 75–80 nt of usable target sequence.
• Remove or narrow any /.../ exclusion regions — they may be blocking too much of the target.
• Verify you are not targeting the ITR region, which is excluded by design.
• Try slightly expanding the allowed probe length range (e.g., 33–42 nt) if your probe design criteria are flexible.

• Confirm all final concentrations and the template volume are filled in correctly — any missing entry is treated as 0 and excluded.
• The calculator uses the reaction volume field as the total. Water (or buffer) is added automatically to reach that total; if the components already exceed the reaction volume, a negative water volume will be shown.
• Check that stock concentrations are in the correct units — stock and final concentrations must use the same unit system (both in µM, or both in mM, etc.).

• Confirm exactly 4 fields are filled and 2 are left empty. Providing 5 or 6 values over-constrains the system.
• For pure dilution (adding water/buffer), set C₂ = 0, not blank — blank means "unknown".
• If a calculated volume is negative, the combination of concentrations and volumes is physically impossible (e.g., the desired final concentration is higher than both stock concentrations).
• Ensure all concentration values use the same units and all volume values use the same units.

If the page suddenly stops working after a server update (buttons do nothing, tabs don't switch, no results), the browser is likely using a cached JavaScript file.

• Confirm the ID is correct (e.g., NCBI nucleotide accession like A02710; rsIDs like rs4988235).
• Network/firewall policies may block external API calls; use manual FASTA upload instead.
• Try again later if the upstream service is rate-limiting or temporarily unavailable.

• Enable Non-specific priming control and increase the minimum complexity threshold.
• Run TotalRepeats on your target to identify repeat coordinates, then add /.../ exclusion markup around them.
• For multiplex panels: tighten the primer Tm window.

• Ensure sequences are in the correct assembly order in the FASTA file.
• Verify that adjacent fragments share ≥20 bp overlapping sequence with a Tm ≥50°C for exonuclease processing.
• If using vector sequences at the ends, confirm they contain the appropriate homology regions matching the adjacent insert ends.
• Widen the Tm window (e.g., 58–64°C) or increase the maximum primer length to allow more candidate primers.

• Try increasing the Max F2-B2 amplicon size (default 200 bp; try up to 350 bp).
• Widen the Tm range slightly (e.g., 58–63°C) to allow more inner-primer candidates.
• Disable Non-specific priming control temporarily to confirm a set can be generated on the current sequence, then re-enable it.
• Use [ ... ] markup to direct the tool to the most unique subregion of a long target sequence.