Quick start
- Open a tool from the menu (e.g., Primer Design, KASP, LAMP, Gibson Assembly).
- Provide input:
- Paste sequences in FASTA format, or
- Upload a FASTA file, or
- Retrieve sequence by an accession/variant ID (where supported).
- Adjust parameters (primer length, Tm, product size, assay options).
- Click Generate (or Analysis). Results appear in the output tabs — copy/paste to Excel when needed.
Input formats
FASTA
Use standard FASTA with a header line starting with > and one or more lines of sequence:
>Seq1
ACGTTGCAACGTTGCAACGTTGCA
>Seq2
TTTACCGGAACTGACTGACTName + sequence (PrimersList)
The PrimersList tool also accepts space- or tab-separated name sequence pairs (Excel-friendly):
m13-47 cgccagggttttcccagtcacgac
RP tttcacacaggaaacagctatgacAllowed nucleotide codes
Standard and degenerate bases are accepted using IUB/IUPAC codes:
- N=A/C/G/T, R=A/G, Y=C/T, S=G/C, W=A/T
- K=G/T, M=A/C, B=C/G/T, D=A/G/T, H=A/C/T, V=A/C/G
- U=Uracil, I=Inosine
Targeting markup inside sequences
Several tools allow you to constrain primer placement directly inside the sequence by adding markup characters.
Square brackets ([, ]) mark regions where primer binding or variants should be evaluated.
...ACCTG [A/T] GGTCA...Use /.../ to exclude regions from primer placement (can be repeated multiple times).
...ACCTG /REPEAT/ GGTCA...Exact interpretation depends on the specific tool. When in doubt, keep the input unmarked and use parameter filters.
PCR primer design
Applies to: PCR / Multiplex / qPCR / RPA
- Primer length and Tm range: define the design window; keep primer pairs within a narrow Tm interval for multiplex.
- Product size range: match the downstream method (e.g., short for qPCR/RPA; longer for Sanger).
- Minimal linguistic complexity: helps avoid low-complexity / repetitive regions and reduces spurious priming.
- Non-specific priming control: enable to reduce off-target binding in repetitive genomes.
- Multiplex PCR: favors primer sets with reduced cross-dimers; use tighter Tm bounds.
- TaqMan / MGB probe assays: enable one option at a time; probes are designed within the amplicon under assay-specific constraints.
- RPA: shifts to longer primers and short amplicons suitable for ~37–42 °C isothermal workflows.
- Inverse PCR: assume circular template; ensure the marked region is consistent with circular amplification logic.
- C>>T bisulfite conversion: converts non-CpG cytosines for in silico evaluation on bisulfite-treated sequences.
- Overlapping primers: relaxes constraints on overlap where necessary (use cautiously).
Sequences are expected to be represented in the standard IUB/IUPAC nucleic acid codes. Acceptable letters:
- N = A, C, G, T
- R = A, G (purine)
- Y = C, T (pyrimidine)
- S = G, C (strong)
- W = A, T (weak)
- K = G, T (keto)
- M = A, C (amino)
- B = C, G, T (not A)
- D = A, G, T (not C)
- H = A, C, T (not G)
- V = A, C, G (not T)
- U = Uracil
- I = Inosine
The structure of the last nucleotides at the 3′-end of the primer can be specified to control primer specificity:
N— any pattern (no constraint)- One, two, or more characters using standard or mixed letters
- Multiple patterns of equal length separated by spaces:
sws ssw sww wss www
For example, WSS corresponds to all 3′-end variants: acc acg agc agg tcc tcg tgc tgg.
Measures the "vocabulary richness" of a genetic text by counting nucleotide combinations relative to the theoretical maximum. 100% = highest possible level.
Measures "harmony" of genetic text by counting possible purine-pyrimidine combinations relative to the theoretical maximum. 100% = maximum possible level.
The pre-designed primers/probes list is used for multiplexing with prior designed PCR primer/probe sets. This allows you to incorporate existing validated assays into new multiplex panels while ensuring compatibility and avoiding cross-reactivity.
Design of specific PCR primers for in silico bisulfite conversion for both strands. Only cytosines not followed by guanine (non-CpG context) will be replaced by thymines. CpG methylation sites are preserved.
Optimal primers should hybridize only to the target sequence. Common problems include annealing to repetitive sequences (retrotransposons, transposons, inverted tandem repeats), alternative product amplification, and multiple bands due to off-target binding.
Minor Groove Binders (MGBs) selectively bind non-covalently to the minor groove of the DNA helix, enabling shorter probe lengths and superior quenching for highly specific TaqMan-type assays.
Genotyping (KASP / AS-PCR)
Applies to: KASP primers assay design
The tool computes primers for Kompetitive Allele Specific PCR (KASP) or Allele-Specific Quantitative PCR (ASQ). One Allele-Specific Primer (ASP) is computed for each input allelic variant, plus one common primer (Universal Primer, UP) targeting a conserved region.
Input sequences should be in FASTA format with the variant of interest enclosed in [square brackets]. Supported formats:
[First allele/Second allele]— e.g.,[A/G][First/Second/Third/Fourth]— for multi-allelic variants[IUPAC code]— e.g.,[R]for A/G,[S]for G/C[Target Nucleotide]— single nucleotide if only one allele needs targeting
Keep flanking regions long enough to allow design of allele-specific primers away from problematic local repeats.
>1
gctctctgtgtctgatccaagaggcgaggccagtttcatttgagcattaa[A/G]tgtcaagttctgcacgctatcatcagggg
>2
tcatattccagtttgggcgagttttaagataggtccgg[S]acagtctttgcggcgccaacgcgtctttctccag[S] represents G/C using the IUPAC ambiguity code.
Leave one side empty for deletions:
>1
tcatattccagtttgggcgagttttaagataggtccgg[AG/]acagtctttgcggcgccaac>1
tgggcagcattagtagaagaaagtacaagaccgtgtgtagagg[GATATACTTGAG/CAGTCC]agcagatagcgttggatagThe [square brackets] should surround all SNPs that are part of the haplotype. Nearby SNPs not part of the haplotype should be outside brackets and identified using an IUPAC code.
ASP primers can carry standard KASP FAM and HEX tails (LGC Biosearch Technologies). Paste tails in FASTA-like format in the dedicated tab:
>FAM
GAAGGTGACCAAGTTCATGCT
>HEX
GAAGGTCGGAGTCAACGGATTCustom tails can be used instead of the standard sequences.
Enter one or more rsIDs (space/comma separated), select a species, and set the desired flank size. The tool retrieves the flanking sequence from Ensembl and populates the input area automatically. For human variants, a direct retrieval from NCBI is also available via kasp2.html.
In silico PCR
Applies to: In silico PCR
- Searches for primer/probe (or gRNA/miRNA-like) binding sites across provided sequences.
- Predicts likely amplicons within configured product-size constraints.
- Reports mismatches and provides a log of hits/off-targets.
- Paste/upload target sequences in FASTA.
- Provide the primer/probe list in the dedicated tab.
- Run analysis and review both Results and Log output tabs.
- If no output: confirm hits exist within the allowed product size range, and verify primer orientation (forward/reverse).
LAMP primer design
Applies to: LAMP primer sets design tool
- Paste/upload target sequence in FASTA or retrieve by NCBI accession.
- Set primer constraints (length, Tm) and maximum F2–B2 amplicon size.
- Enable Loop Primer Design for faster amplification (LF/LB).
- Click Generate and review both output tabs: Primer list and LAMP primer sets.
- F2 to B2 (5′ ends): 120–160 bp
- F2 to F3: 0–20 bp
- B2 to B3: 0–20 bp
- 5′ of F2 to 3′ of F1: 0–40 bp
- 5′ of B2 to 3′ of B1: 0–40 bp
| Primer type | Target Tm |
|---|---|
| F1c / B1c / LF / LB (inner primers & loops) | 64–66°C |
| F2 / B2 / F3 / B3 (outer primers) | 59–61°C |
- Use
[ ... ]to constrain primer design to a specific region. - Use
/ ... /to exclude regions (e.g., repeats) from primer placement; can be repeated.
Enabling C→T bisulfite conversion automatically adjusts the default length (17–28 nt), Tm (57–59°C), and overlapping primer settings — suitable for designing LAMP primers on bisulfite-converted templates for methylation analysis.
Gibson Assembly primer design
Applies to: Gibson Assembly Primer Design
Gibson assembly enables seamless joining of multiple DNA fragments in a single isothermal reaction using a 5′ exonuclease, DNA polymerase, and DNA ligase. Fragments must share ≥20 bp homology with adjacent segments (overlap Tm ≥50°C).
- Arrange all DNA fragments in the intended final assembly order in a single FASTA file. Include vector sequence as the first and last entries for circular construct design.
- Optionally, paste any pre-existing primers in the Pre-designed Primers tab to avoid duplicating them in the new set.
- Adjust primer length, Tm range, and 3′-end pattern, then click Generate.
- Review the Report (Primer list) tab for individual primers and the PCR primer pairs tab for the complete set of amplification reactions.
- Sequences must be in FASTA format, listed in the desired assembly order.
- Adjacent fragments must share an overlap of ≥20 bp with a Tm ≥50°C to ensure efficient exonuclease digestion and annealing.
- For circular constructs, include vector (backbone) sequence at both the first and last positions. The tool will automatically generate primers spanning the junction.
- Fragment names (FASTA headers) are used in the output to label each primer pair — use meaningful names.
- Length range: annealing part of the primer (not including the overlap tail). Default 18–23 nt.
- Tm range: controls the melting temperature of the annealing portion of each primer. Default 60–62°C.
- Min. linguistic complexity (%): avoids low-complexity or repetitive primer sequences.
- 3′-end pattern: use
Nfor any nucleotide, or specify patterns likeWSSto ensure a strong 3′ terminus.
- Report (Primer list): all designed primers with name, sequence, length, Tm, GC%, and LC% values.
- PCR primer pairs: grouped by fragment, showing the forward and reverse primer for each PCR reaction needed to amplify the assembly inserts with their overlap tails.
- Overlap tails are shown in lowercase (or visually distinguished) in the primer sequences; the annealing portion is in uppercase.
Multiplex tiling PCR panel design
Applies to: Custom multiplex tiling PCR panel design tool
- Splits a target region into overlapping amplicons (tiling) and designs primers for sequencing panels.
- Generates two complementary pools (Panel A and Panel B) to reduce primer competition across adjacent amplicons.
- Reports primer lists and ready-to-use panel mixes for multiplex PCR workflows.
- Target sequence(s) in FASTA. Mark the region with
[and]; exclude problem areas with/.../. - Amplicon size range: choose by platform (e.g., shorter for Illumina; longer for ONT).
- Gap between amplicons: set to 0 for full coverage; increase for fewer primers.
- Optional pre-designed primers: provide a list for compatibility with existing assays.
Gator BLI probe design
Applies to: Oligo Probe Design for the Gator® GeneSwift Assay Kit
Designs paired oligo probes for the Gator Bio GeneSwift Assay Kit, which determines AAV vector titer by biolayer interferometry (BLI). A two-step procedure combines lysis and genome hybridization in one tube, followed by BLI detection.
Each assay requires a matched pair of probes that hybridize to the same strand of the target sequence:
- 35–40 nt long
- Labeled only at the 5′ end with fluorescein
- 35–40 nt long
- Biotins added at both 5′ and 3′ ends
- Also carries a 30-T spacer (poly-T tail)
- Pick any region within the insert except the Inverted Terminal Repeats (ITRs).
- For genome integrity assessment, target the ends of the insert, e.g., the CMV enhancer at one end and SV-40 at the other.
- Use
[…]directly inside the pasted sequence to pin each probe's location individually. - Use
/…/to exclude problematic regions (repetitive elements, secondary structure hotspots) from probe placement; can be repeated multiple times.
- Probe length (35–40 nt): length of each individual oligo probe.
- Probes distance (>5 nt): minimum gap (in nucleotides) separating the two probes along the target strand. The tool also reports pairs at the configured separation.
- Calculated energy: probe self-folding energy should be above −10 kcal/mol to minimize homo- and hetero-dimer formation.
- Linguistic Complexity (LC%): measures sequence vocabulary richness; 100% = maximum diversity. Higher values reduce non-specific hybridization risk.
- Paste or upload sequences in FASTA format; name is optional but recommended (e.g.,
>EGFP). - Retrieve a sequence directly from NCBI by entering a nucleotide accession ID (e.g.,
A02710) and clicking Retrieve Sequence. - The name and sequence string can be separated by either a space or a tab; style must be consistent for all entries.
- Input is case-insensitive; only standard IUPAC nucleic acid characters are accepted.
- Results are reported as FWD (forward strand, positive strand) and RVS (reverse strand, negative strand) probe pairs in separate tabs.
- Pairs are presented in ranked order; test several top-ranked pairs to determine the most optimal one experimentally.
- Submit the final probe sequences to an oligo manufacturer (e.g., Eurogentec, LGC Biosearch Technologies, Eurofins) with the appropriate fluorescein and biotin modifications specified.
PrimerAnalyser
Applies to: PrimerAnalyser — comprehensive single-oligo analysis
Provides comprehensive analysis of a single oligonucleotide sequence with standard and mixed bases (DNA/RNA, methylated, locked nucleic acids, phosphorothioates). Results update instantly as you type.
- Melting temperature Tm (°C)
- GC content (%)
- Linguistic complexity (LC% and YR%)
- Length (nt) and base composition
- Self-dimers and G-quadruplex detection
- Extinction coefficient ε (L/mol·cm)
- Molecular weight (g/mol)
- Amount per OD unit (nmol/OD260)
- Mass per OD unit (µg/OD260)
- Dilution and resuspension calculator
- Paste a single oligo sequence (5′→3′) with or without a FASTA name header.
- Standard IUB/IUPAC degenerate codes are supported (N, R, Y, S, W, K, M, B, D, H, V).
- U = Uracil (RNA), I = Inosine.
- LNA codes:
E=LNA-dA,F=LNA-dC,J=LNA-dG,L=LNA-dT. - Tm calculations use nearest-neighbor thermodynamic parameters, accounting for primer concentration, salt, and Mg²⁺.
Three calculators are available:
- Dilution: calculate stock volume needed to reach a target working concentration and volume.
- Resuspension: calculate how much TE/water to add to a lyophilised oligo to reach a desired stock concentration.
- Amount from OD/mass/nmol: inter-convert between OD260, mass (µg), and nanomoles using the oligo's extinction coefficient and molecular weight.
- Primer concentration (0.01–5 µM): concentration of the oligo used in your reaction.
- Total salt concentration (Na⁺, K⁺, NH₄⁺, Tris⁺; 1–1000 mM): matches your buffer conditions.
- Mg²⁺ concentration (0–10 mM): free magnesium concentration in your reaction.
- Dimer sensitivity (1–10): controls the detection threshold for self-dimer reporting.
PrimersList
Applies to: PrimersList — batch primer analysis
Analyzes multiple primers simultaneously in a single run: Tm, GC%, secondary structures (hairpins, self-dimers, cross-dimers), linguistic complexity, molecular weight, extinction coefficient, and OD calculations.
Accepts two equivalent formats:
>m13-47
cgccagggttttcccagtcacgac
>RP
tttcacacaggaaacagctatgacm13-47 cgccagggttttcccagtcacgac
RP tttcacacaggaaacagctatgac- Features: tabular summary — Tm, GC%, LC%, length, base composition, Mw, extinction coefficient, OD values — one row per primer.
- Dimers: self-dimer and cross-dimer analysis for all primer combinations, ranked by binding strength.
PrimersList handles specialized oligonucleotide types:
- Molecular beacons — stem-loop probes; the stem sequence lowers the apparent Tm and affects dimer analysis.
- Scorpion primers — self-probing amplification primers with an internal probe region.
- Standard degenerate primers, RNA oligonucleotides (
U), and LNA-modified sequences (E/F/J/L).
Multiple Sequence Alignment (MUSCLE-JS)
Applies to: MUSCLE-JS Multiple Sequence Alignment
Browser-based pairwise and multiple sequence alignment using algorithms inspired by MUSCLE. Supports Needleman–Wunsch (global) and Smith–Waterman (local) for pairwise alignment, plus progressive MSA for multiple sequences.
- Paste or upload sequences in FASTA format. Two sequences trigger pairwise alignment; three or more trigger progressive MSA.
- Select the alignment algorithm (global/local) if prompted, or leave the default for standard DNA/RNA sequences.
- Click Align and review the visual output (coloured alignment) or switch to FASTA/CLUSTAL export format.
The tool automatically detects and corrects sequence orientation (forward vs. reverse-complement) before alignment. This is especially useful when working with Sanger sequencing reads or assembly contigs that may be reported in either direction. Corrected orientations are flagged in the output.
- Visual: colour-coded alignment shown directly in the browser for quick inspection.
- FASTA: aligned sequences with gap characters (
-), suitable for downstream phylogenetic or variant analysis. - CLUSTAL: standard interleaved CLUSTAL format compatible with most alignment viewers.
TotalRepeats
Applies to: TotalRepeats — repeat identification and masking
Rapid de novo identification, masking, visualization, and clustering of all repetitive sequences at genomic scale. Detects direct and inverted repeats, microsatellites (SSRs), telomeric sequences, and complex higher-order repeat structures.
- Direct repeats: tandemly arranged identical or near-identical sequences on the same strand.
- Inverted repeats: palindromic sequences that can form hairpin/stem-loop secondary structures.
- Microsatellites (SSRs): short tandem repeat units (1–6 nt motifs) repeated in tandem arrays.
- Telomeric sequences: species-specific hexanucleotide repeat units at chromosome ends.
- Higher-order repeats: complex arrays of repeated blocks built from other repeat types.
- Paste or upload one or more sequences in FASTA format.
- Select the repeat types to detect and set minimum repeat unit / copy number thresholds.
- Click Analyze. Results are reported per sequence with coordinates and consensus repeat units.
- Use the masking output to generate a repeat-masked FASTA for primer design tools (paste it into PCR / LAMP / KASP tool inputs).
Repeat-rich regions are a major source of primer design failures. The recommended workflow is:
- Run TotalRepeats on your target sequence to identify repeat coordinates.
- Export the masked sequence (repeat regions in lower case) or manually add
/…/exclusion markup around identified repeat coordinates. - Paste the masked/marked sequence into the PCR, KASP, LAMP, or Assembly tool for repeat-aware primer design.
The browser-based tool is suitable for sequences up to a few Mb. For whole-genome analyses, use the command-line TotalRepeats Java application, which supports unlimited input size.
PCR / LAMP Reaction Mix Calculator
Applies to: PCR, LAMP or any reaction setup calculator
Calculates the exact volume of each reagent to add when preparing PCR, qPCR, or LAMP reaction mixtures. Choose a preset polymerase/kit to auto-fill typical stock and final concentrations, then scale to any number of reactions and reaction volume.
- Select your polymerase or kit from the drop-down menu. Default values for buffer, MgCl₂/MgSO₄, dNTP, and polymerase concentrations are loaded automatically.
- Enter the number of reactions and reaction volume (µl). The total master-mix volume is computed automatically.
- Adjust stock and final concentrations for any component (primers, probes, DMSO, ROX, SYBR Green II, etc.) to match your specific reagents.
- The output table updates instantly and lists the volume (µl) of each component to pipette.
- Standard Taq DNA Polymerase
- Phusion DNA Polymerase
- Phire Hot Start II DNA Polymerase
- Deep VentR DNA Polymerase
- KAPA HiFi DNA Polymerase
- Herculase II Fusion DNA Polymerase
- Pfu DNA Polymerase
- Long PCR (Taq + Pfu blend)
- LongAmp Taq DNA Polymerase
- LAMP (Bst 2.0 Polymerase — isothermal buffer with MgSO₄, Betaine support)
All reagent labels and concentrations are editable. Available slots include:
- PCR buffer (label editable)
- MgCl₂ or MgSO₄ (mM)
- dNTP mix (mM)
- Forward and reverse primers (µM) — or FIP/BIP for LAMP
- Up to 4 additional probes or primers (e.g., F3/B3, loop primers for LAMP)
- An extra component slot with a custom unit label (e.g., Betaine, enzyme enhancer)
- DMSO (%), ROX reference dye (×), SYBR Green II (×)
- Primary polymerase (U/µl) and optional secondary Pfu polymerase (U/µl)
- DNA template volume (µl)
- Set a final concentration of 0 for any component you do not need — it will be excluded from the output.
- Include a 5–10% overage by entering a slightly higher number of reactions (e.g., 11 instead of 10) to account for pipetting losses.
- For LAMP, the preset loads the full 6-primer set (FIP, BIP, F3, B3, FLOOP, BLOOP) with recommended concentrations and isothermal buffer.
- Export the result table with Ctrl+A → Ctrl+C → paste into Excel or your lab notebook.
Universal Two-Solution Mixing and Dilution Calculator
Applies to: Universal Two-Solution Mixing and Dilution Calculator
A general-purpose laboratory calculator for mixing two solutions of known concentrations. Provide any 4 of the 6 variables and the remaining 2 are computed automatically. Works with any consistent unit system (M, mM, %, mass fraction; volumes in L, mL, or µl).
- C₁ — concentration of the stock solution
- V₁ — volume of stock to use
- C₂ — concentration of the solvent (use
0for pure water/buffer) - V₂ — volume of solvent to add
- Cf — desired final concentration
- Vf — desired final volume (= V₁ + V₂)
0 is a valid entry (e.g., C₂ = 0 for dilution with pure water). Leave a field empty only when it is truly unknown.
| # | Task | Unknown(s) |
|---|---|---|
| 1 | Mix 400 mL of 25% with 100 mL of 15% — find final concentration | Cf |
| 2 | Mix pH 9.0 and pH 7.0 to reach pH 7.6 in 100 mL (linear approx.) | V₁, V₂ |
| 3 | Dilute 100 mL of 0.5 M stock with 200 mL water — find concentration | Cf |
| 4 | Blend 10% and 5% to get 30 gal of 7% solution | V₁, V₂ |
| 5 | Add 10% to 40 gal of 35% to reach 20% | V₂, Vf |
| 6 | Mix 60% and 20% alcohol to make 20 gal of 30% | V₁, V₂ |
| 7 | Blend 90% gold with unknown alloy for 30 oz of 80% gold | C₂, V₂ |
- Units must be consistent across all concentration fields (all in mM, all in %, etc.) and across all volume fields (all in mL, µl, etc.).
- pH mixing uses a linear approximation (C₁·V₁ + C₂·V₂ = Cf·Vf), valid only for rough educational estimates; true pH requires accounting for buffer capacity and activity coefficients.
- The tool assumes ideal mixing (volumes are additive). In practice, some solutions (e.g., concentrated sulfuric acid) show significant volume changes on mixing.
- The formula applied is the standard mixing equation:
C₁V₁ + C₂V₂ = CfVf.
Exporting results
- For tables in
<textarea>outputs: click inside, then Ctrl+A (select all) → Ctrl+C (copy) → paste into Excel/Sheets. - If a tool produces multiple outputs (e.g., primer list and primer pairs), switch tabs before copying.
- When pasting into spreadsheets, use "Split text to columns" if a fixed delimiter (space or tab) is used.
- For PrimersList's Features tab, horizontal scrolling may be needed — paste with wrapping disabled (
wrap="off"is set).
Troubleshooting
- Verify that you clicked Generate (or Analysis) and that output is shown in the correct result tab.
- Reduce constraints (widen Tm range by 1–2°C; allow slightly longer/shorter primers) and try again.
- Confirm the sequence contains valid characters only (A/C/G/T and allowed degenerate codes); remove spaces or non-ASCII characters.
- Open the browser console (F12 → Console) and check for JavaScript errors.
- Reduce the probe distance parameter if the target region is short — a very large required gap can exhaust available candidates.
- Confirm the input sequence is long enough: two non-overlapping 35–40 nt probes plus the required distance gap requires at least 75–80 nt of usable target sequence.
- Remove or narrow any
/.../exclusion regions — they may be blocking too much of the target. - Verify you are not targeting the ITR region, which is excluded by design.
- Try slightly expanding the allowed probe length range (e.g., 33–42 nt) if your probe design criteria are flexible.
- Confirm all final concentrations and the template volume are filled in correctly — any missing entry is treated as 0 and excluded.
- The calculator uses the reaction volume field as the total. Water (or buffer) is added automatically to reach that total; if the components already exceed the reaction volume, a negative water volume will be shown.
- Check that stock concentrations are in the correct units — stock and final concentrations must use the same unit system (both in µM, or both in mM, etc.).
- Confirm exactly 4 fields are filled and 2 are left empty. Providing 5 or 6 values over-constrains the system.
- For pure dilution (adding water/buffer), set C₂ =
0, not blank — blank means "unknown". - If a calculated volume is negative, the combination of concentrations and volumes is physically impossible (e.g., the desired final concentration is higher than both stock concentrations).
- Ensure all concentration values use the same units and all volume values use the same units.
If the page suddenly stops working after a server update (buttons do nothing, tabs don't switch, no results), the browser is likely using a cached JavaScript file.
- Windows/Linux: Ctrl+F5 or Ctrl+Shift+R
- macOS: Cmd+Shift+R
- Press F12 to open DevTools
- Right-click the reload button → Empty cache and hard reload
../js/panel.js?v=20260312. Update the version string after every deployment.
- Confirm the ID is correct (e.g., NCBI nucleotide accession like
A02710; rsIDs likers4988235). - Network/firewall policies may block external API calls; use manual FASTA upload instead.
- Try again later if the upstream service is rate-limiting or temporarily unavailable.
- Enable Non-specific priming control and increase the minimum complexity threshold.
- Run TotalRepeats on your target to identify repeat coordinates, then add
/.../exclusion markup around them. - For multiplex panels: tighten the primer Tm window.
- Ensure sequences are in the correct assembly order in the FASTA file.
- Verify that adjacent fragments share ≥20 bp overlapping sequence with a Tm ≥50°C for exonuclease processing.
- If using vector sequences at the ends, confirm they contain the appropriate homology regions matching the adjacent insert ends.
- Widen the Tm window (e.g., 58–64°C) or increase the maximum primer length to allow more candidate primers.
- Try increasing the Max F2-B2 amplicon size (default 200 bp; try up to 350 bp).
- Widen the Tm range slightly (e.g., 58–63°C) to allow more inner-primer candidates.
- Disable Non-specific priming control temporarily to confirm a set can be generated on the current sequence, then re-enable it.
- Use
[ ... ]markup to direct the tool to the most unique subregion of a long target sequence.
Data & privacy
- All computations are performed locally in your browser (client-side JavaScript); your sequences are never sent to our servers.
- Optional retrieval functions (NCBI/Ensembl) send requests directly to those external services only when you click "Retrieve".
- If you work with sensitive or proprietary sequences, prefer manual FASTA upload and use an offline/local copy of the tools where applicable.