Allele-Specific PCR (AS-PCR) - KASP™ (Kompetitive Allele Specific PCR) or PACE™ (PCR Allele Competitive Extension) or Allele-Specific Quantitative PCR (ASQ) - based genotyping assay designs for multiallelic discrimination of single nucleotide polymorphisms (SNPs) and insertions and deletions (InDels) at specific loci. The application provides professional facilities for genotyping assay design for SNP/InDel-specific KASP assay-targeting primers (KASP Assay Mix).
Input format: Sequence(s) can be pasted or uploaded as a file in FASTA format or retrieved flanked sequence SNP sequences from the Ensembl database. One or multiple SNP/variant rsIDs (comma or space separated: rs4988235 rs1357617 rs2046361 rs717302 rs917118) were used to retrieve the surrounding sequence (±flank bases) and enter the species name (homo_sapiens, mus_musculus, rattus_norvegicus, bos_taurus, danio_rerio, arabidopsis_thaliana etc). Size Limitations: The length of the query sequence and size of the batch file are theoretically unlimited.
Alternatively, direct retrieval of flanked SNP sequences in the human genome.
| Reverse primer design option | ||
| Length range (12-100 nt): | - | |
| Tm range (°C): | - | |
| Minimal Linguistic Complexity (70-90%): | ||
| Variants of the 3'-end composition (5'-3'): | ||
| SNP located at the 3'-end of ASP (1..): | ||
- Sequences are expected to be represented in the standard IUB/IUPAC nucleic acid codes are acceptable letters: B=(C,G,T), D=(A,G,T), H=(A,C,T), K=(G,T), M=(A,C), N=(A,C,G,T), R=(A,G), S=(G,C), V=(A,C,G), W=(A,T), Y=(C,T), U=Uracil, I=Inosine.
- Variants of the 3'-end composition (5'-3'): the structure of the last nucleotides at the 3'-end of the primer, it can be specified by "N" for any pattern, or it can be encoded by one, two, three or more characters of standard or mixed letters. It is possible to specify one or more patterns (separated by spaces and of equal length): sws ssw sww wss www. For example, the pattern WSS corresponds to all variants of the 3'-end composition: acc acg agc agg tcc tcg tgc tgg.
- Linguistic sequence complexity (LC%) is a measure of the 'vocabulary richness' of a genetic text, based on counting the number of possible nucleotide combinations ('entropy' of the set of possibilities) relative to the theoretical maximum. This sequence value is converted into a percentage, with 100% representing the highest possible level.
- The input contains nucleotide sequences of allelic variants which are used to compute primers for Kompetitive Allele Specific PCR (KASP) or Allele-Specific Quantitative PCR (ASQ). In this example, allele-specific PCR is being designed to genotype SNP alleles. The SNP of interest must be enclosed in [square brackets] and can be formatted as [First allele/Second allele/Third allele/Fourth allele] or [IUPAC code] or [Target Nucleotide].
- Optionally, use two ‘/.../’ signs for the start and end of the excluded region (this is possible multiple times).
- Primer tails list: ASP can be designed according standard KASP guidelines (LGC Biosearch Technologies) carrying the standard FAM (5′-GAAGGTGACCAAGTTCATGCT-3′) and HEX (5′-GAAGGTCGGAGTCAACGGATT-3′) tails. Automatically adding 5′-tails to each primer. The input data should have the following FASTA style, although the name should be optional:
>FAM
GAAGGTGACCAAGTTCATGCT
>HEX
GAAGGTCGGAGTCAACGGATT
Example 1. Formatting sequences for SNP:
>1
gctctctgtgtctgatccaagaggcgaggccagtttcatttgagcattaa [A/G] tgtcaagttctgcacgctatcatcatcaggggccgaggcttctctttgtt
>2
tcatattccagtttgggcgagttttaagataggtccgg [S] acagtctttgcggcgccaacgcgtctttctccagcagacagtccccggactgc
>3
tcatattccagtttgggcgagttttaagataggtccgg [C] acagtctttgcggcgccaacgcgtctttctccagcagacagtccccggactgc
Allele-specific PCR (AS-PCR) assays can be designed for discrimination of insertions/deletions (InDels) polymorphisms. The program imposes no size limit on length difference for InDels alleles, provided that all alleles can be aligned, and the alignment has a sufficient length of overlapping to target primers. Two, three or four allelic variants may be included for analysis to compute allele-specific primers (ASPs). Only differences between the variants must be shown within the brackets. One Allele-Specific Primer (ASP) will be computed for each of the input allelic variants. Also, one common primer (Universal Primer, UP) will be computed which targets a conserved region in all sequences. Input sequences should be in a FASTA format with differences between alleles placed within square brackets: [allele1/allele2/allele3/allele4].
Example 2. Formatting sequences for InDels:
>1
tcatattccagtttgggcgagttttaagataggtccgg [AG/] acagtctttgcggcgccaacgcgtctttctccagcagacagtccccggactgc
Example 3. Detection of Multi-Nucleotide Variants (MNV) is possible using KASP. Sequence information for MNVs should be submitted using the [allele1/allele2] format:
>1
tgggcagcattagtagaagaaagtacaagaccgtgtgtagaggatactct [GATATACTTGAG/CAGTCC] agcagatagcgttggataggcgacaggattattggagcgccgtcgagaac
Example 4. KASP assays can be designed to detect Haplotypes of any size. Sequence information for haplotypes should be submitted using the [allele1/allele2] format. The [square brackets] should surround all SNPs that are part of the haplotype. Any nearby SNPs that are not considered to be part of the haplotype should be outside of the square brackets and should be identified using the appropriate IUPAC ambiguity code.
>1
caaacaccaaactggtgagtcgtggtttacaacacgggagttcaaaactg
[TATCCGAATGACGAATGTTCACGTCCTTAAAC
/CATCCGAATCACGAATGTTCAGTTCCTTTAAG]
catcatgaaatgagtttagtttgggtggctcgtaagtagacataaggcac
С >> T bisulfite conversion (bisulfite modified genome)
Sequence, design of specific PCR primers for in silico bisulphite conversion for both strands - only cytosines not followed by guanidine (CpG methylation) will be replaced by thymines:5’aaCGaagtCCCCa-3' 5’aaCGaagtTTTTa-3'
||||||||||||| -> ||||||:|::::|
3’ttGCttCaggggt-5' 3’ttGCttTaggggt
Non-specific priming control
Oligonucleotide specificity is one of the most critical factors for good PCR; optimal primers should hybridize only to the target sequence, especially when using complex genomic DNA as a template. Amplification problems can occur when primers anneal to repetitive sequences (retrotransposons, transposons or inverted tandem repeats). Alternative product amplification can also happen when primers are complementary to inverted repeats and produce multiple bands. However, the generation of inverted repeat sequences is exploited in two common generic DNA fingerprinting methods (RAPD).