Skip to main content

In silico or virtual PCR or primers (probes) searching

Reference notes and workflows for FastPCR Module 13. Use the table of contents to jump to sections.


The aim of in silico (digital or virtual or electronic PCR) is to calculate theoretical PCR results by using DNA sequence(s) and primers (probes).
This in silico tool is very attractive for quick analysing primer or probe through target sequences, for determination primer (probe) location, orientation, efficiency of binding, complementarity and Tm calculation.

FastPCR

The prediction appropriated short or long primer (probe) annealing site is only one way for PCR product prediction. Primer can bind many predicted sequences in template(s), but only sequences with few mismatches (1 or 2 depends from place and nucleotide) at 3’end of primer can be used for polymerase extension. The last 10-12 bases at 3’end of primer are sensitive to initiation of polymerase extension and general primer stability on binding template site. Single mismatch at these last 10 bases at 3’end of primer depends from the position and the structure can slightly reduced the primer binding and PCR efficiency. This software allows simultaneously testing single primer or list of the individual primer or probe with any length thorough multiplex target sequences. This test control by primer complementarity to target sequence performed with fast no gap alignment.

Oligonucleotides with degenerated sequence are fine for performing this test.
Probe with not complemental tail on 5’end and on 3’end to target is not problem for performing this test.
The probable PCR product can found for linear and cycle molecular, for standard, inverted PCR and for multiplex PCR.


Web tool for in silico PCR.

  • Enter primer sequences: Paste the primer sequence(s) in the additional editor in any format acceptable for FastPCR
  • C >> T bisulphite conversion: bisulphite modified genome sequence, design of specific PCR primers for in silico bisulphite conversion for both strands - only cytosines not followed by guanidine (CpG methylation) will be replaced by thymines;
  • Restrict analysis to F/R primer pairs: the program will recognise paired primers (Forward F Reverse R) (see below).
    For this type of analysis, primers from the same pair(s) must have identical names but finishing using “R or F” (e.g. >seq1R and >seq1F form a pair; ). The name length and structure (including "F" and "R" inside names) are not important. Moreover, the program is not limited in one unique pair per primers: for one "Forward" primer, it can be several "reverse", the same for “reverse” primer:
1aF agggagtagcttacctcgctg
2bF gcgaaaaccaagtgcttacct
3cF tcctcaagcgaaaaccaatcc
1aR ggtttcgtcggtcgctgcttc
2bR agtcaacggcgtcgcagcgttc
3cR ggtcgcgacatccgttccaa

In silico PCR against whole genome(s) or a list of chromosomes

Open User must specify a directory by click on any file within a directory. The program will be sequentially read and analyze each file individually and test primer pairs or the primers (probes) list. Files can contain one or more FASTA sequence with standard IUB/IUPAC nucleic acid codes characters. This software allows simultaneously testing single primer or list of the individual primer or probe with any length thorough multiplex target sequences.







Navigation
Return to the FastPCR landing page or open the documentation section.