Skip to main content

FastPCR Quick PCR Commands Help

Search and browse the most commonly used commands and options for PCR primer/probe design.

Filters rows in all tables by command, description, and support status.
How to read
Commands are shown as typed in FastPCR. Some items accept ranges (e.g., -ln18-24) or patterns (IUPAC). “Online support” indicates availability in FastPCR online service.

PCR commands

Command Description Online support
/? Loading current options of PCR primers design: /?
no
-iPCR Inverted PCR:

{ -ipcr }

yes
-npd -Fnpd -Rnpd Exclude primers design, but external primers can be added with the -fpr[] command:

{ -Fnpd -Fpr[attccattccgcgttcga/cgttacggtatttcttgc] }

yes
-pcrNo PCR primers design only, no PCR primer combinations reporting (is equivalent to "-npc0" command):
> -pcrNO

yes
( N1-N2 ) specify the minimal and maximal size requested for the PCR product, N1 for shortest, N2 for the longest PCR product; (N1) or (N1-N2) is allowed:
> (400-500)

yes
-pdN1-N2 -FpdN1-N2 -RpdN1-N2 -pdN1-N2/N3 Primer Design to define position of the target DNA on initial N1 and final N2 position (N2>N1) in DNA sequence:
> -pd350-700

design PCR primers between coordinate N1 and N2 (N2>N1) for Forward or Reverse:
> -Fpd100-500 -Rpd1000-1200

User can specify the area in which to search for primers around the area (-pdN1-N2/N3), for example, interested area 400-500, and we want to pick up primers surrounding the site within 100 bases, whereas the primers for Forward will be between 300-400, and 500-600 for Reverse:
> -pd400-500/100
this command is equal to -Fpd300-400 -Rpd500-600

generally: -pdN1-N2/N3 is equal to -Fpd(N1-N3)-N2 -RpdN2-(N2+N3)

yes
-pdN-e -FpdN-e -RpdN-e Design PCR primers in area: from the end of sequence minus N bases design left or right PCR primers from the end of sequence minus N bases:
> -Fpd200-e
> -Rpd200-e
yes
-excludeN1-N2 -excludeN-e The Excluded Region List(s) denotes locations where primers and probe must not bind. Multiple excluded regions may be defined per sequence. This feature can be used to avoid unwanted regions (ex. intron, SNP etc). For example, if the excluded region is bases 500-1000 for the target selection need use the command:
> -exclude500-1000

An alternative way is to use two sign '\' for the start and end of such excluded region (possible multiple times):

>example1
[gtcccgagaacctgagtatgcatcacccggatcgcttcttcc\gggaggtgttggggg\ ctatctcggtgttttctgactgcttggcttccgcgagtcattgccatgctagcgta]
[attgcaataaccggagcgagatgatgcacc\ccccc\ccttgacaagcgccaataccacgcactattaagagtaaaaaaaa]

yes
-pr[NNN/NNN] -Fpr[NNN/NNN] -Rpr[NNN/NNN] External primer(s) for use in PCR analysis, at 5'->3', with a "/" to separate the primers, automatic detection of the location of the primer with mismatches;:

> -pr[attccattccgcgttcga/tcctacgttccgttacc]

pre-designed Forward PCR primer: 
> -Fpr[attccattccgcgttcga/cgttacggtatttcttgc]

yes
-npcN Determine the maximum Number of Primers Combinations, for example 10 (-npc0 is equivalent to "-pcrNo" command):
> -npc10
yes
-nprN -FnprN -RnprN Showing maximal Number of designed Primers per task:
> -npr10

yes
-dtmsN Synchronizing Tm for Primer Pair (±°C):
> -dtms10
yes
-prioritylen The length of primers or probes is prioritised, while the rest of the parameters (Tm, CG, dG) remains uncontrolled:
> -prioritylen
no

Primer design options control

Option Description Online support
-lnN1-N2 -FlnN1-N2 -RlnN1-N2 -PlnN1-N2 Determines the range of primer length (12-500 nt), N1(Minimal)-N2(Maximal) length of primers (ex., between 18 to 32 nt: -ln18-35) or probes (ex., between 12 to 28 nt: -pln12-28):
> -FlN18-22 -RlN22-22
yes
-tmN1-N2 -FtmN1-N2 -RtmN1-N2 -PtmN1-N2 Determines the range of primer Tm, N1(Minimal)-N2(Maximal) Tm of primers or probe:
> -Ftm40-50 -Rtm50-60

yes
-3tmN1-N2 -F3tmN1-N2 -R3tmN1-N2 Determines the range of primer Tm at 3’end, N1(Minimal)-N2(Maximal) Tm for last 12 bases at the 3'-end of primers:
> -F3tm31-35 -R3tm35-45

yes
-qN -FqN -RqN -PqN Primer Quality (PQ) (virtual PCR efficiency) is the theoretical primer PCR efficiency value, it is recommended closer to 90%. By default -q70, but it can be reduced to -q50, in situations where primers are cannot be designed with the default option.
> -Fq50 -Rq90

yes
-lcN -FlcN -RlcN -PlcN Linguistic sequence complexity (LC), this value is in percentage (20-100%), it is recommended closer to 90%. By default -lc70, but it can be reduced to -lc50, in situations where primers are cannot be designed with the default option.
> -lc60 -Pq70

yes
-dmr=N -Fdmr=N -Rdmr=N -Pdmr=N The level of sensitivity for primer-dimer detection, default value is 1 (as the strictest criterion), the higher the value, the lower the detection sensitivity, if the value is 0, the program will not assess for the presence of primer-dimers, the optimal value of this parameter is 2, as the most realistic. N from 0 to 5. Level 1 is the default and is the most stringent criterion, the value of 5 for insensitive detection.
> -dmr=0

yes
-opYes|No -FopYes|No -RopYes|No Primers overlapping control: if type -FopNo, all forward primers will not overlap; -RopYes all reverse primers will overlap:
> -FopNo -RopYes

yes
-ctYes|No -FctYes|No -RctYes|No -PctYes|No (Copy Test) Non-specific priming control is avoiding primer design on repeated sequences in the DNA template. By default, this command is -ctYes, checking the secondary (non-specific) binding test.
> -FctYes -RctNo

yes
-x3e -fx3e -Ffx3e -Rfx3e -fx5e -Ffx5e -Rfx5e Design PCR primer for a specific sequence on the fixed 5' or 3' ends to selected sequence, for example, if user need to link all primers to 5'end of sequence, use -fx5e, program will show all primers with the same location but different length. The same situation is for a linkage the 3'end of primers to a certain location:

> -fx3e
yes
-c3[NNN/NNN] -Fc3[NNN/NNN] -Rc3[NNN/NNN] -c5[NNN/NNN] -Fc5[NNN/NNN] -Rc5[NNN/NNN] -Pc5[NNN/NNN] Specifies for primers 3’ends with these patterns with three bases per pattern. Certain sequence(s) in the direct or complementary (second c) orientation for Forward or Reverse primers (probes) 3' or 5'-ends nucleotide composition or an indication of a specific sequence location; the program accept the universal degenerate DNA code (IUB/IUPAC), and minimum 2 bases in length and maximum for the primer length:

[NNN/NNN] - for any bases, example for Forward primers -c3[RRY] is equivalent to -c3[aat/gat/agt/ggt/aac/gac/agc/ggc]; accepted the sequences with different lengths:

> -c3[wss/wss/ssw]
> -c3[ACCC/TTCG]

yes
-z3eNameEnzyme -Fz3eNameEnzyme -Rz3eNameEnzyme Primers (probes) directly designed to the restriction enzyme site at 3' end.“NameEnzyme” is the restriction enzyme name:
example, this is as the alternative command: –c3YCATG^R is the same as –z3eXceI:

> -Fz3eXceI

Result: 3’end of all primers contains sequences: YCATGR
For not included enzymes in FastPCR database, this command will be ignored.
no
-5e[NNN] or -5e[NNN/NNN] -F5e[NNN] -R5e[NNN] -P5e[NNN] Adding non-template DNA sequences to primer ends: adding sequence to the 5’end with command: ‘-5e[NN]’ or adding sequence to the 3’end with command: ‘-3e[NN]’, where ‘NN’ is a sequence of one or more bases, for example:
‘-F5e[CGACG] -R5e[TTTTTT]’, adds sequence ‘CGACG’ to forward primers and sequence ‘TTTTTT’ to reverse primers at 5’ends. For tasks in which it is necessary to specify several allelic variants with individual added tail sequences, which can be indicated with a separator, the forward slash character "/" is used to denote each tail variant. For example, for bi-allelic scoring of single nucleotide polymorphisms (SNPs) and insertions with deletions (Indels) at specific loci in relation to the development of competitive allele specific PCR (AS-PCR) genotyping assays, the two allele-specific primers will be added with the standard FAM (5′-GAAGGTGACCAAGTTCATGCT-3′) and HEX (5′-GAAGGTCGGAGTCAACGGATT-3′) tails at the 5′ end:

> -F5e[gaaggtgaccaagttcatgct/gaaggtcggagtcaacggatt]


yes
-3e[NNN] or -3e[NNN/NNN] -F3e[NNN] -R3e[NNN] -P3e[NNN] Adding non-template DNA sequences to primer ends: adding sequence to the 3’end with command: ‘-3e[NN]’, where ‘NN’ is a sequence of one or more bases, for example:
‘-F3e[CGACG] -R3e[TTTTTT]’, adds sequence ‘CGACG’ to forward primers and sequence ‘TTTTTT’ to reverse primers at 3’ends.
> -F3e[GG] -R3e[CC]
yes
-excludeIUPAC -nomxbpr Avoidance of degenerate (mixed, ambiguous) IUPAC nucleotides within primer/probe sequences.
N - allowed number of degenerate nucleotides in the primer sequence; the default is 0; no more than 2 degenerate bases in the primer sequence: -nomxbpr2
no

Special cases

Feature Description Online support
-AsPCRN Allele-specific polymerase chain reaction (AS-PCR): KASP™ (Kompetitive Allele Specific PCR) or PACE™ (PCR Allele Competitive Extension) based genotyping assay design for biallelic (or up to four variants) discrimination of single nucleotide polymorphisms (SNPs) and insertions and deletions (Indels) at specific loci.
N - the number (length) of polymorphic nucleotides from the 3'end; the default is 2 (-asPCR2), where the SNP is located at the penultimate base from the 3'-end of primer. Recommended minimum 2, in this case, SNP is located at the penultimate base from the 3'-end of primer; for InDels variants, this number is equal to polymorphic nucleotides at the 3'-end.

If user do not specify the number: -asPCR, in this case the program will automatically determine the optimal length for effective discrimination of single nucleotide polymorphisms.

In this example, the command (-P5e[gaaggtgaccaagttcatgct/gaaggtcggagtcaacggatt]) is indicated of adding of 2 variants of 5'-tail sequences for each allelic variant and the amplicon size is not more than 150 nucleotides (40-150):

{ -aspcr2 -P5e[gaaggtgaccaagttcatgct/gaaggtcggagtcaacggatt] (40-150) }
>example1
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [C/G] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

>example2
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [S] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

Advanced example - 3 InDels variants:

> -aspcr3 -P5e[gaaggtgaccaagttcatgct/gaaggtcggagtcaacggatt/gaaggtcggagtcaacggacc]

TAAGAGCTGAAGAGCTAGCTGGCTAGCTGATTAA [ATAT/CC/A] AGCTGCTAGACGTCGCAGTCGACACTGACGTCCTAGGACAAAGTCTCGTG

yes
-ASqPCRN Allele-specific quantitative (real-time) polymerase chain reaction (AS-qPCR) - genotyping assays are based on competitive allele-specific qPCR and enable specific-allelic scoring of single nucleotide polymorphisms (SNPs) and insertions and deletions (InDels) at specific loci. The AS-qPCR Assay mix contains assay-specific non-labeled oligos: allele-specific forward primers and one common reverse primer with one common TaqMan/MGB-probe as a reporter.
N - the number (length) of polymorphic nucleotides from the 3'end; the default is 2 (-asqPCR2), where the SNP is located at the penultimate base from the 3'-end of primer. Recommended minimum 2, in this case, SNP is located at the penultimate base from the 3'-end of primer; for InDels variants, this number is equal to polymorphic nucleotides at the 3'-end.

If user do not specify the number: -asqPCR, in this case the program will automatically determine the optimal length for effective discrimination of single nucleotide polymorphisms.

>MGB-example: -ASqPCR2 -ln16-28 -Tm54-56 -pln12-28 -pTm53-57
gagagtgaccgattgcgtatacctgaacaactaacccccatcggccatcgcagtggcgctcccggcactgagaaaacgtccctaaccttgtgccccg
ctcacatagacagcgataacaattttatgagatatcggctgtttaggaagtgcaaatgttaacgactgtct [ATAGACGTCGATCGT/]
tacgatataagtgccaagataagacttcggaattaaatacttgggtttctacccgcaatacgaggtgcatgtgcaccatttcgatatcatgaggtgg
ttgtggactagatgcatagctctttctattattgtgctgccattcacgctccaggagaccttacccagttt

>TaqMan-example: -ASqPCR1 -ln16-28 -Tm54-56 -pln12-28 -pTm59-63
gagagtgaccgattgcgtatacctgaacaactaacccccatcggccatcgcagtggcgctcccggcactgagaaaacgtccctaaccttgtgccccg
ctcacatagacagcgataacaattttatgagatatcggctgtttaggaagtgcaaatgttaacgactgtct [ATAGACGTCGATCGT/]
tacgatataagtgccaagataagacttcggaattaaatacttgggtttctacccgcaatacgaggtgcatgtgcaccatttcgatatcatgaggtgg
ttgtggactagatgcatagctctttctattattgtgctgccattcacgctccaggagaccttacccagttt

no
-castPCRN The castPCR® - competitive, allele-specific TaqMan PCR utilizes an allele-specific primer for mutant allele detection that competes with an MGB blocker oligonucleotide to suppress the wild-type background and enable specific-allelic scoring of single nucleotide polymorphisms (SNPs) and insertions and deletions (InDels) at specific loci.

N - the number (length) of polymorphic nucleotides from the 3'end; the default is 2 (-castPCR2), where the SNP is located at the penultimate base from the 3'-end of primer. Recommended minimum 2, in this case, SNP is located at the penultimate base from the 3'-end of primer; for InDels variants, this number is equal to polymorphic nucleotides at the 3'-end.

If user do not specify the number: -castPCR, in this case the program will automatically determine the optimal length for effective discrimination of single nucleotide polymorphisms.

>CastPCR-example1: -CastPCR -ln16-28 -Tm54-56 -pln12-28 -pTm53-57
gagagtgaccgattgcgtatacctgaacaactaacccccatcggccatcgcagtggcgctcccggcactgagaaaacgtccctaaccttgtgccccg
ctcacatagacagcgataacaattttatgagatatcggctgtttaggaagtgcaaatgttaacgactgtct [S]
tacgatataagtgccaagataagacttcggaattaaatacttgggtttctacccgcaatacgaggtgcatgtgcaccatttcgatatcatgaggtgg
ttgtggactagatgcatagctctttctattattgtgctgccattcacgctccaggagaccttacccagttt

>CastPCR-example2: -CastPCR -ln16-28 -Tm54-56 -pln12-28 -pTm53-57
gagagtgaccgattgcgtatacctgaacaactaacccccatcggccatcgcagtggcgctcccggcactgagaaaacgtccctaaccttgtgccccg
ctcacatagacagcgataacaattttatgagatatcggctgtttaggaagtgcaaatgttaacgactgtct [CC/AA]
tacgatataagtgccaagataagacttcggaattaaatacttgggtttctacccgcaatacgaggtgcatgtgcaccatttcgatatcatgaggtgg
ttgtggactagatgcatagctctttctattattgtgctgccattcacgctccaggagaccttacccagttt

no
-SNaPshot The SNaPshot® Multiplex System is a primer extension-based method for genotyping known SNP positions through the automated DNA analyzer invented by Applied Biosystems. Through its multiplexing capability, up to 10 SNPs can be analyzed in a single reaction by using unlabeled, user-defined primers.

{ -snapshot -pTm52-54 -pln16-35 -popyes }
>example1
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [W] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

>example2
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [S] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

no
-MLPA A Multiplex Ligation Assay (MLA) or a digital MLA (dMLA) - MLPA® Multiplex Ligation-dependent Probe Amplification is a technology designed to detect copy number changes (deletions and duplications) in genomic DNA invented by MRC Holland that allows detection of DNA copy number changes of up to 40 sequences in a single reaction. MLPA has a variety of applications including detection of mutations and single nucleotide polymorphisms, analysis of DNA methylation, relative mRNA quantification, chromosomal characterisation of cell lines and tissue samples, detection of gene copy number, detection of duplications and deletions and aneuploidy determination.

{ -mlpa -pTm62-65 -pln21-50 -P5e[GGGTTCCCTAAGGGTTGGA/TCTAGATTGGATCTTGCTGGCAC] }
>example1
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [A] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

>example2
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [CC] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

no
-LUXpdN1-N2 -FLUXpd -RLUXpd LUX (Light Upon eXtension) primer design. LUX fluorogenic (self-quenched) Forward primers desig for quantitative PCR, between coordinate N1 and N2 for left or right sequence side. The design factors are the presence of either a C or G as the terminal 3′ nucleotide of the primer, the fluorophore being attached to the second or third base (T) from the 3′ end, the presence of one or more Gs within the 3 nt flanking the labeled nucleotide and, for hairpin primers, the existence of a 5′ tail that is complementary to the 3′ end of the primer. The 5′ tail forms a blunt-end hairpin at temperatures below its melting point. The stem of the hairpin primers have a ΔG ranging from –1.6 to –5.8 kcal/mol.

Example, design forward LUX primers:

> -Fluxpd
[ctccccagacctatgttgtaagtggtcatgatacatgactagggtagagagaggagtgtctgtcaaaaaaga][ctgcgtgccctgagcttagctaccggttgaggtatctgagggactaccagtaacagatccccaggaattagccagaaaaaa]

> -LUXpd100-200
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagcagctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

no
-tiling[±N] Design of overlapping [<0] and non-overlapping [>0] DNA amplicons in a single-tube multiplex PCR for targeted next-generation sequencing (DNA-Based Molecular Tagging System):

-tiling[-120] is negative value of N, meaning overlapping amplicons at about 120 bp;
-tiling[20] value of N is positive (or 0) for non-overlapping amplicons.
no no
-TaqMan -MGB -Beacon An example using MSA as a target for genotyping assay design.
Allele-specific quantitative PCR with TaqMan-MGB probe - genotyping assays are based on competitive allele-specific TaqMan-MGB probe and enable specific-allelic scoring of single nucleotide polymorphisms (SNPs) and insertions and deletions (InDels) at specific loci. The AS-qPCR Assay mix contains assay-specific non-labeled oligos: forward and reverse primer with allele-specific MGB.

{ -mgb -ln16-28 -Tm54-56 }

alignment
     10        20        30        40        50        60 
      |         |         |         |         |         | 
1  GCTCCCGGCACTGAGAAAACGTCCCTAACCTTGTGCCCCGCTCACATAGACAGCGATAAC
2  GCTCCCGGCACTGAGAAAACGTCCCTAACCTTGTGCCCCGCTCACATAGACAGCGATAAC

     70        80        90       100       110       120
      |         |         |         |         |         |
1  AATTTTATGAGATATCGGCTGTTTAGGAAGTGCAAATGTTAACGACTGTCTTACGATATA
2  AATTTTATGAGATATCGGCTGTTTAGGAAGTGCA-----------------TACGATATA 

      130       140       150       160       170       180
        |         |         |         |         |         |
1  AGTGCCAAGATAAGACTTCGGAATTAAATACTTGGGTTTCTACCCGCAATACGAGGTGCA
2  AGTGCCAAGATAAGACTTCGGAATTAAATACTTGGGTTTCTACCCGCAATACGAGGTGCA

      190       200       210       220       230       240
        |         |         |         |         |         |
1  TGTGCACCATTTCGATATCATGAGGTGGCATTGGCGGAACTTGTGGACTAGATGCATAGC
2  TGTGCACCATTTCGATATCATGAGGTGGCATTGGCGGAACTTGTGGACTAGATGCATAGC

    250       260       270       280       290 
      |         |         |         |         | 
1  TCTTTCTATTATTGTGCTGCCATTCACGCTCCAGGAGACCTTACCCAGTTT
2  TCTTTCTATTATTGTGCTGCCATTCACGCTCCAGGAGACCTTACCCAGTTT

no
-ssr/N -ssr Design PCR primers to Simple sequence repeat (SSR) loci, the software automatically finds SSR loci and will design primers:
N is optional value for distance before (Forward primers) and after (Reverse primers) SSR loci:
> -ssr/200
yes
Navigation
Return to the landing page or open the documentation section.