Skip to main content

PCR set-up examples

Practical parameter sets and design notes for common assay types. Copy the command patterns and adapt length/Tm windows to your targets and chemistry.

Key constraints include primer region distances, Tm windows (commonly ~52–54°C), and avoiding secondary structures.

Example parameters
{ -lamp1 -ln18-24 -tm52-54 }
  • F2–B2 distance typically 120–200 bp; F2–F3 and B2–B3 typically 0–20 bp.
  • Loop-forming regions typically 0–40 bp.
  • Minimize primer-primer complementarity; avoid AT-rich 3′ ends.
LAMP primer design example
Illustrative LAMP design schematic.

Efficiency and specificity depend on the adjusted melting temperatures of limiting vs excess primers. A practical rule is TmL − TmX ≥ 5°C.

Example parameters
-Ftm50-55 -Rtm64-68 -dTMs12
LATE-PCR example

PCR primer design to SSR loci

Genotyping

Design primers around SSR loci (e.g., 200 bp flanking window).

Example parameter
-ssr/200
SSR PCR example

Prediction Ta (annealing temperature) and amplicon length

QC

Predict annealing temperature and PCR fragment length(s) for one or more existing primers on the current sequence.

Example
{ -FPR[gcgaaaaccaagtgcttacctcg atactccctccgtccctaaa] -npd }
Ta example 1
Ta example 2

How to add adapter sequences (5′ / 3′ / both ends)

Add non-template sequences to primer ends for downstream handling (restriction sites, secondary amplification, barcoding, or platform-specific adapters). FastPCR can optionally convert to complementary sequence using c.

Examples
-F5eCGACG or -R5eTTTTTT -Fc5eCGACG (convert to complement at 5′)

Examples
-F3eGGTTC or -R3eCCTT -Fc3eGGA (convert to complement at 3′)

Example
-F3eGG -F5eGG

For secondary PCR amplification, consider using random DNA as a template to generate unique adapter parts (and screen for unwanted secondary structure if adapters are long).

Navigation
Return to the landing page or open the documentation section.