PCR set-up examples

Practical parameter sets and design notes for common assay types. Copy the command patterns and adapt length/Tm windows to your targets and chemistry.

On this page

Primer design for performing LAMP (Loop-mediated Isothermal Amplification)

Isothermal

Key constraints include primer region distances, Tm windows (commonly ~52–54°C), and avoiding secondary structures.

Example parameters
{ -lamp1 -ln18-24 -tm52-54 }
  • F2–B2 distance typically 120–200 bp; F2–F3 and B2–B3 typically 0–20 bp.
  • Loop-forming regions typically 0–40 bp.
  • Minimize primer-primer complementarity; avoid AT-rich 3′ ends.
LAMP primer design example
Illustrative LAMP design schematic.

Linear-After-The-Exponential (LATE)-PCR

Asymmetric PCR

Efficiency and specificity depend on the adjusted melting temperatures of limiting vs excess primers. A practical rule is TmL − TmX ≥ 5°C.

Example parameters
-Ftm50-55 -Rtm64-68 -dTMs12
LATE-PCR example

PCR primer design to SSR loci

Genotyping

Design primers around SSR loci (e.g., 200 bp flanking window).

Example parameter
-ssr/200
SSR PCR example

Prediction Ta (annealing temperature) and amplicon length

QC

Predict annealing temperature and PCR fragment length(s) for one or more existing primers on the current sequence.

Example
{ -FPR[gcgaaaaccaagtgcttacctcg atactccctccgtccctaaa] -npd }
Ta example 1
Ta example 2

How to add adapter sequences (5′ / 3′ / both ends)

Add non-template sequences to primer ends for downstream handling (restriction sites, secondary amplification, barcoding, or platform-specific adapters). FastPCR can optionally convert to complementary sequence using c.

Examples
-F5eCGACG or -R5eTTTTTT -Fc5eCGACG (convert to complement at 5′)

Examples
-F3eGGTTC or -R3eCCTT -Fc3eGGA (convert to complement at 3′)

Example
-F3eGG -F5eGG

For secondary PCR amplification, consider using random DNA as a template to generate unique adapter parts (and screen for unwanted secondary structure if adapters are long).

Navigation
Return to the landing page or open the documentation section.
Back to Home Documentation