PrimerDigital
jPCR
PCR tool provides comprehensive facilities for designing primers for most PCR applications including standard, multiplex, long distance, inverse, real-time, unique, group-specific, bisulphite modification assays, and in silico PCR analysis;
tool for identifying simple sequence repeat (SSR) loci by analysing the low complexity regions of input sequences;
in silico PCR primers and probes search, prediction of probable PCR products and search of potential mismatching location of the specified primers or probes;
analyzes different features of multiple primers simultaneously, e.g. Tm, GC content, dimer formation and else
Java application FastPCR software compatible and they give the same result.
Write, paste or load from file your sequences to the Sequence window.
The analyzer accepts text or table format (can be copied from an Excel file, for example).
The name and sequence string can be separated with either space or tab, as long as the style is the same for all the sequences.
For individual, selective options and task, sequences need convert to FASTA format with “>”, these options have a highest priority. Any of these following commands must be written AFTER the sequence name or “> ” (these commands are not case sensitive) and press Enter and the end of line. The commands can occupy any place in the command line.
Degenerate primer sequences are also accepted:
IUPAC code is an extended vocabulary of 15 letters which allows the description of ambiguous DNA code. Each letter represents a combination of one or several nucleotides:B=(C,G,T), D=(A,G,T), H=(A,C,T), K=(G,T), M=(A,C), N=(A,C,G,T), R=(A,G), S=(G,C), V=(A,C,G), W=(A,T), Y=(C,T).
С >> T bisulphite conversion: bisulphite modified genome sequence, design of specific PCR primers for in silico bisulphite conversion for both strands - only cytosines not followed by guanidine (CpG methylation) will be replaced by thymines:
5’aaaCGaagtCCg-3' 5’aaaCGaagtTTg-3'
|||||||||||| -> ||||||| | |
3’tttGCttCaggC-5' 3’tttGCttTaggC-5'
For individual, selective options and task, sequences need convert to FASTA format with “>”, these options have a highest priority, and they are covering the general (background) options. All these command used optionally and only for advanced tasks.
The results will appear instantly in the output tab result-windows, and can be saved or copied and pasted to other programs (Word, Excel, etc.) or print.
The result contains a list of the best primers and compatible primer combinations. Each primer combination includes information for primer position and length, the melting temperature and optimal melting temperature and product(s) length.
Any of these following commands must be written AFTER the sequence name or “> ” (these commands are not case sensitive) and press Enter and the end of line. The commands can occupy any place in the command line.
| (N1-N2) |
specify the minimal and maximal
size requested for the PCR product, N1 for shortest, N2
for the longest PCR product: > (400-500) |
| -TagN1-N2 |
to define position of the
target DNA on initial N1 and final N2 position in DNA
sequence: > -Tag350-700 |
|
-FpdN1-N2 -RpdN1-N2 |
(Primer Design) design PCR
primers between coordinate N1 and N2 for Forward or Reverse: > -Fpd100-500 -Rpd1000-1200 |
|
-FlnN1-N2 -RlnN1-N2 |
Minimal-Maximal length for
Forward or Reverse primers design:
> -Fln18-22 -Rln22-22 |
|
-FtmN1-N2 -RtmN1-N2 |
Minimal-Maximal Tm for Forward
or Reverse primers design:
> -Ftm40-50 -Rtm50-60 |
|
-FcgN1-N2 -RcgN1-N2 |
Minimal-Maximal CG% for Forward
or Reverse primers design:
> -Fcg45-55 -Rcg50-60 |
|
-F5e -R5e |
Primer 5'-End Tail, additional DNA sequence to 5' of primers (probes) (any length): > -F5eCGACG -R5eTTTTTT |
|
-F3e -R3e |
Primer 3'-End Tail, additional DNA sequence to 3' of primers (probes) (any length): > -F3eGG -R3eСС |
| -ptmsN1 |
Synchronizing Tm for Primer Pair (±°C):
> -ptms10 |
Instead
of using these commands –FpdN1-N2,
–RpdN1-N2
or -TagN1-N2,
for individual targets selection for Forward or Reverse primers in a
particular
location, you can apply any multiple
combinations of '[
]' with '] [' inside the
sequence(s).
Use
of these brackets differs from software Primer3,
for example:
1. The same location for both Forward and
Reverse primers will be designed in the central [nnnnnnnnnn] part
(only once '[
]' is
used):
...[AAAAAAAAAA[nnnnnn]CCCCCCC]...
Multiplex PCR can be carried out simultaneously within a single sequence with multiple tasks as well as for different sequences or multiple tasks or both cases together.
All possible combinations of '[ ]' with '] ['
inside the sequence(s):
1. [ ]
2.
] [
3.
[ ] [ ]
4.
[ [ ] ]
5.
([ ] [ ])n or (and) ([ [ ] ])n
Output Result
Application automatically generate results in "Results Tab" at tabulated format (ready for transferring to Excel sheet), output results is easy to save as .XLS Text file, compatible for Excel or Open Office or copy-paste to clipboard:PrimerID Sequence(5'-3') Length(bp) Tm(°C) CG(%) Linguistic_complexity(%) Primer_Quality(%)
1F1_1_68-89 tcagaagtacgcttgtagcttg 22 54.8 45.5 90 90
1F2_1_82-103 gtagcttgtgcaacctaacaca 22 55.7 45.5 93 83
1F3_1_168-188 agagatgaagccctggctact 21 57.5 52.4 94 96
1R1_1_558-578 tagcccaaatggtggttgctg 21 58.4 52.4 93 95
1R2_1_522-542 tggccaaaatggtggttgttg 21 57.3 47.6 85 90
1R3_1_501-521 tggaaatgcttgttgcggtgg 21 59.2 52.4 91 97
1R4_1_429-450 gttgtgggatagtttgttgtgg 22 54.7 45.5 74 85
1R5_1_406-426 atggttgttgcggttggaagg 21 58.8 52.4 84 93
1R6_1_347-367 tgtggctgttgtgggatgggt 21 61.4 57.1 82 94
Primers ID designed format:
PCR product output, each line contains compatible primer pair (Forward and Reverse primers):
PrimerID Sequence(5'-3') Tm(°C) PrimerID Sequence(5'-3') Tm(°C) PCR_Fragment_Size(bp) Topt(°C)
1F1_1_68-89 tcagaagtacgcttgtagcttg 54.8 1R1_1_558-578 tagcccaaatggtggttgctg 58.4 511 58.4
1F1_1_68-89 tcagaagtacgcttgtagcttg 54.8 1R2_1_522-542 tggccaaaatggtggttgttg 57.3 475 58.3
1F1_1_68-89 tcagaagtacgcttgtagcttg 54.8 1R4_1_429-450 gttgtgggatagtttgttgtgg 54.7 383 57.9
Examples for PCR primer design to Simple Sequence Repeat (SSR) loci:
-ssr/N or -ssr
Design PCR primers to SSR loci software automatically finds Simple Repeats target Sequence and will design primers:
N is optional value for distance before (Forward primers) and after (Reverse primers) SSR loci:
> -ssr/200
Contact
Dr. Ruslan Kalendar
Viikinkaari 1 (P.O.Box 65) Biocenter 3
00014 University of Helsinki
Tel: +358-9-19158869
fax: +358-9-19159930
ruslan.kalendar*helsinki.fi
Java application needs a Java Virtual Machines (Sun) (the Java Runtime Environment (JRE) or complete Java Development Kit (JDK), for programmers only, can be downloaded from java.com).
Copyright © 2010 Ruslan Kalendar, PrimerDigital All rights reserved.
The copyrights and other rights to the materials on the PrimerDigital website are owned by PrimerDigital. You are authorized to view, download and reproduce the materials at this website only for your internal information purposes provided that you: (i) retain all notices contained in the original materials; (ii) only use images with surrounding text relating to the images; and (iii) include the following copyright notice:
These computer programs are protected by copyright law and international treaties. Unauthorized reproduction or distribution of this program, or any portion of it, may be result in severe civil and criminal penalties, and will be prosecuted to the maximum extent possible under law.
No transcoding: you are prohibited from using these softwares with a commercial software or hardware product ("commercial product") whose purpose is to "transcode" or convert applets content into an alternate programs. A commercial product is one that directly or indirectly generates revenue for its author and/or publisher.
Copyright © 2010 PrimerDigital.
All rights reserved.