LAMP Primer Design Tool

The application is based on FastPCR software and provides professional facilities for designing primers for Loop-mediated Isothermal Amplification (LAMP) applications. LAMP is a highly sensitive, specific, and rapid DNA amplification technique that has revolutionized molecular biology research and clinical diagnostics. LAMP reactions take place under isothermal conditions and do not require special thermal cyclers. LAMP uses 6 primers recognizing 8 distinct regions of target DNA for a highly specific amplification reaction. Four 'core' primers are necessary for amplification, and two additional 'loop' primers accelerate the reaction. The core primers generate DNA that contains two regions of inverted self-complementarity. This forms the self-hybridizing loop structure at both ends of the target sequence, leading to a "dumbbell" structure. The structure contains multiple opportunities for initiating synthesis, and the strand displacing Bst DNA Polymerase uses these priming points, resulting in rapid exponential amplification. This generates the concatemers mentioned above – long repeats of the short target sequence in a concise amount of time. DNA products are very long (>20 kb) and formed from numerous repeats of the brief (200–350 bp) target sequence, connected with single-stranded loop regions in long concatamers.

The results will appear instantly in the output fields (lower windows). The results can be copied and pasted to other programs (Word, Excel, etc.).

The user can specify individually for each sequence location for both Forward and Reverse primers design using ‘[‘ and ‘]’ inside each sequence.
Optionally - use two ‘/.../’ signs for the start and end of the excluded region (this is possible multiple times).

All possible combinations of '[ Forward ]' with '[  Reverse ]' within the sequence(s):
1.  [        ]
2.  [  ]  [  ]
3.  [  [  ]  ]

• Distance between primer regions. The distance between 5' end of F2 and B2 is considered to be 120-200 bp and the distance between F2 and F3 as well as B2 and B3 is 0-20bp. The distance for loop forming regions (5' of F2 to 3' of F1, 5' of B2 to 3' of B1) is 0-40bp.
  
• Tm value for primer: F1c/B1c/LF/LB about 64-66°C and F2/B2/F3/B3 about 59-61°C.
• Secondary structure: primers should be designed so as not to form secondary structures, 3'end sequence should not be AT rich or complementary to other primers.
• Linguistic sequence complexity (LC%) is a measure of the 'vocabulary richness' of a genetic text based on counting the number of possible combinations of nucleotide combinations ("entropy" of the set of possibilities) to the theoretically possible one. This value for sequence is converted to percentages, 100% being the highest level.
• A name is required for sequence(s) (eg. seq1 agtcagtcagtcagtcagtc).
• Degenerate primer sequences are also accepted. Each letter represents a combination of one or several nucleotides: B=(C,G,T), D=(A,G,T), H=(A,C,T), K=(G,T), M=(A,C), N=(A,C,G,T), R=(A,G), S=(G,C), V=(A,C,G), W=(A,T), Y=(C,T).

С >> T bisulfite conversion (bisulfite modified genome)

Sequence, design of specific PCR primers for in silico bisulphite conversion for both strands - only cytosines not followed by guanidine (CpG methylation) will be replaced by thymines:

5’aaCGaagtCCCCa-3'        5’aaCGaagtTTTTa-3'
  |||||||||||||     ->      ||||||:|::::| 
3’ttGCttCaggggt-5'        3’ttGCttTaggggt

Non-specific priming control

Oligonucleotide specificity is one of the most critical factors for good PCR; optimal primers should hybridize only to the target sequence, especially when using complex genomic DNA as a template. Amplification problems can occur when primers anneal to repetitive sequences (retrotransposons, transposons or inverted tandem repeats). Alternative product amplification can also happen when primers are complementary to inverted repeats and produce multiple bands. However, the generation of inverted repeat sequences is exploited in two common generic DNA fingerprinting methods (RAPD).