KASP primers assay design tool

Allele-Specific PCR (AS-PCR) - KASPâ„¢ (Kompetitive Allele Specific PCR) or PACEâ„¢ (PCR Allele Competitive Extension) or Allele-Specific Quantitative PCR (ASQ) based genotyping assay design for multiallelic discrimination of single nucleotide polymorphisms (SNPs) and insertions and deletions (Indels) at specific loci. The application is based on FastPCR software and provides professional facilities for genotyping assays design for SNP/InDel-specific KASP assay targeting primers (KASP Assay Mix) and the universal Master Mix.

Input Format: Sequence(s) can be pasted or uploaded as a file in FASTA format.

>1 tgaactacggcgtgcgactaccgcggataaacctgtgtaaagaatataagtgttactcg [R] tcaattccgcgatctagttaatccgcttcgttagtcgtattcatgggacagaaattatggacgct >2 tgtccatatgtcgaacggtcagagaccgctgacactagtgca [/ATAGACGTCGATCGT] gttgctccacatggcagaaagaaatgaggatgagtggaaaatccataatcacgatgaac >3 tgggcagcattagtagaagaaagtacaagaccgtgtgtagaggatactct [GATATACTTGAG/CAGTCC] agcagatagcgttggataggcgacaggattattggagcgccgtcgagaac

Primer design:
Minimal length (nt):		Non-specific priming control
Maximal length (nt):		Overlaping primers
Minimal Tm (°C):		C>>T bisulfite conversion
Maximal Tm (°C):
Minimal Linguistic Complexity (%):
SNP position on the 3'-terminus (1-12):

Generate

Clear

To export the results: select all (Ctrl-A), copy (Ctrl-C) and paste (Ctrl-V) to Excel sheet:

• A name is required for sequence(s) (eg. seq1 agtcagtcagtcagtcagtc).
• Degenerate primer sequences are accepted. Each letter represents a combination of one or several nucleotides: B=(C,G,T), D=(A,G,T), H=(A,C,T), K=(G,T), M=(A,C), N=(A,C,G,T), R=(A,G), S=(G,C), V=(A,C,G), W=(A,T), Y=(C,T).
• Linguistic sequence complexity (LC%) is a measure of the 'vocabulary richness' of a genetic text based on counting the number of possible combinations of nucleotides ("entropy" of the set of possibilities) to the theoretically possible one. This value for sequence is converted to percentages, 100% being the highest level. For some Allele-Specific Primers (ASP) there will be a value of LC%=0, indicating the presence of a dimer for this primer, and attention should be paid to this fact.
• The input contains nucleotide sequences of allelic variants which are used to compute primers for Kompetitive Allele Specific PCR (KASP) or Allele-Specific Quantitative PCR (ASQ). In this example, allele-specific PCR is being designed to genotype SNP alleles. The SNP of interest must be enclosed in [square brackets] and can be formatted as [First allele/Second allele/Third allele/Fourth allele] or [IUPAC code] or [Target Nucleotide].
• Optionally, use two ‘/.../’ signs for the start and end of the excluded region (this is possible multiple times).

Example 1. Formatting sequences for SNP:
>1
gctctctgtgtctgatccaagaggcgaggccagtttcatttgagcattaa [A/G] tgtcaagttctgcacgctatcatcatcaggggccgaggcttctctttgtt
>2
tcatattccagtttgggcgagttttaagataggtccgg [S] acagtctttgcggcgccaacgcgtctttctccagcagacagtccccggactgc
>3
tcatattccagtttgggcgagttttaagataggtccgg [C] acagtctttgcggcgccaacgcgtctttctccagcagacagtccccggactgc

Allele-specific PCR (AS-PCR) assays can be designed for discrimination of insertions/deletions (InDels) polymorphisms. The program imposes no size limit on length difference for InDels alleles, provided that all alleles can be aligned, and the alignment has a sufficient length of overlapping to target primers. Two, three or four allelic variants may be included for analysis to compute allele-specific primers (ASPs). Only differences between the variants must be shown within the brackets. One Allele-Specific Primer (ASP) will be computed for each of the input allelic variants. Also, one common primer (Universal Primer, UP) will be computed which targets a conserved region in all sequences. Input sequences should be in a FASTA format with differences between alleles placed within square brackets: [allele1/allele2/allele3/allele4].

Example 2. Formatting sequences for InDels:
>1
tcatattccagtttgggcgagttttaagataggtccgg [AG/] acagtctttgcggcgccaacgcgtctttctccagcagacagtccccggactgc

Example 3. Multi-nucleotide variants. Detection of multi-nucleotide variants (MNV) is possible using KASP. Sequence information for MNVs should be submitted using the [allele1/allele2] format:
>1
tgggcagcattagtagaagaaagtacaagaccgtgtgtagaggatactct [GATATACTTGAG/CAGTCC] agcagatagcgttggataggcgacaggattattggagcgccgtcgagaac

Example 4. Haplotypes. KASP assays can be designed to detect haplotypes of any size. Sequence information for haplotypes should be submitted using the [allele1/allele2] format. The [square brackets] should surround all SNPs that are part of the haplotype. Any nearby SNPs that are not considered to be part of the haplotype should be outside of the square brackets and should be identified using the appropriate IUPAC ambiguity code.
In this situation, the "SNP position on the 3'-terminus" value of 12 or greater can be increased.
>1
caaacaccaaactggtgagtcgtggtttacaacacgggagttcaaaactg
[TATCCGAATGACGAATGTTCACGTCCTTAAAC
/CATCCGAATCACGAATGTTCAGTTCCTTTAAG]
catcatgaaatgagtttagtttgggtggctcgtaagtagacataaggcac

С >> T bisulfite conversion (bisulfite modified genome)

Sequence, design of specific PCR primers for in silico bisulphite conversion for both strands - only cytosines not followed by guanidine (CpG methylation) will be replaced by thymines:

5’aaCGaagtCCCCa-3'        5’aaCGaagtTTTTa-3'
  |||||||||||||     ->      ||||||:|::::| 
3’ttGCttCaggggt-5'        3’ttGCttTaggggt

Non-specific priming control

Oligonucleotide specificity is one of the most critical factors for good PCR; optimal primers should hybridize only to the target sequence, especially when using complex genomic DNA as a template. Amplification problems can occur when primers anneal to repetitive sequences (retrotransposons, transposons or inverted tandem repeats). Alternative product amplification can also happen when primers are complementary to inverted repeats and produce multiple bands. However, the generation of inverted repeat sequences is exploited in two common generic DNA fingerprinting methods (RAPD).