Gibson assembly primer design tool

Gibson assembly is a powerful DNA cloning technique that enables the seamless joining of multiple linear DNA fragments into a single construct. If the fragments contain the necessary overlapping regions, they can be assembled into an intact plasmid. This isothermal, single-reaction method relies on the coordinated activity of a 5′ exonuclease, a DNA polymerase, and a DNA ligase to efficiently fuse overlapping DNA sequences. This approach allows for the precise construction of synthetic and natural genes, genetic pathways, and even entire genomes, making it a valuable tool in molecular engineering. For successful assembly, DNA fragments must typically share at least 20 bp of homology with adjacent segments, ensuring a melting temperature (Tm) of ≥50°C in the overlapping region.

Application Principle: Arrange the DNA fragments in the desired order for assembly. While not mandatory, including the vector sequence at both the beginning and end of the list can help streamline the process.

Input Format: Sequences can be pasted or uploaded as a file in FASTA format.

>pUC19_left
cggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagcttgcatgcctgcaggtcgactctagag 
>1  
gaagcgctctgtccactacaccatgattacttgggggatgaatttaacaatattcctacgcaagatcgtctagcgcttgatacgtgccgattttatctgtagcaatgatgaaaattaactttctacctaggcagtcacagttttttattttccctaatatagcttcgtccttcatcggttgacaaggcgaaagccacctcgcccgcgctgatgaagttgaagactcgccttgacgttaactagatgccggcgacacccacgctagatgcttgcagtggcactgagttctgctcccgcaaagacact
>2 
cgaagggttcgttaccggcttcaacgatcaacgattcaaccccaagttccaacgtcgaaggtggaaatttcggcggagatggctactcctattctaggacgcgaaatcccggcattgggtaacatttgcccagacgcgccacgggtgcggatatcccgactaggtaacgggcaaggagaaagctggtaggcgcatgatgcaggaattgcagcatcagcctaggtgccgagaacatatcggacgatcttcatcccttctgatagggctaaccctgatctatattcaactgcctttattagtattgtggtcaatttattcataccccgacgcatgttcggatttgacctggtcgagaaccgccgcatacgtgtaatagcagtgtcgat
>3  
cccttgatttggagagcacgcgactagaggtgcctgggaagccctaatagcccgtaataacccttagcggcctgcggtccccccggggagacttatcatgtgtaatcccctcccatcagtgcgcgtgatattttatgcagagtaaaccatgaaagataaacgacactctaacgatcgtataatgttcaccccgcgtgcgatattgtcccgacccacattgcactttgcgtcacttggccccgatacctaaactatgctgaggga
>4 
tacgggtaatgtcttactcacgctctcgaaagaacgtgtgtggtagaaaggtaatacattacctctgtgctagttacgacgcgccggtgccttctctcggagacgctcagatggtgtagggtatggggtgtaccatcgttttggattgcgaagactaaggctgcatttagttcaaccgtcctgccggtattacccga
>pUC19_right
gatccccgggtaccgagctcgaattcactggccgtcgttttacaacgtcgtgactggg

Primer design option
Length range (nt):	-
Tm range (°C):	-
Minimal linguistic complexity (%):
Variants of the 3'-end composition (5'-3'):

To export the results: select all (Ctrl-A), copy (Ctrl-C) and paste (Ctrl-V) to Excel sheet.

Sequences are expected to be represented in the standard IUB/IUPAC nucleic acid codes are acceptable letters: B=(C,G,T), D=(A,G,T), H=(A,C,T), K=(G,T), M=(A,C), N=(A,C,G,T), R=(A,G), S=(G,C), V=(A,C,G), W=(A,T), Y=(C,T), U=Uracil, I=Inosine.

Variants of the 3'-end composition (5'-3'): the structure of the last nucleotides at the 3'-end of the primer, it can be specified by "N" for any pattern, or it can be encoded by one, two, three or more characters of standard or mixed letters. It is possible to specify one or more patterns (separated by spaces and of equal length): sws ssw sww wss www. For example, the pattern WSS corresponds to all variants of the 3'-end composition: acc acg agc agg tcc tcg tgc tgg.

Pre-designed list of primers/probes. Pre-designed primers/probes list is used for multiplexing with prior designed PCR primer/probe sets.

Linguistic sequence complexity (LC%) is a measure of the 'vocabulary richness' of a genetic text based on counting the number of possible combinations of nucleotides ("entropy" of the set of possibilities) to the theoretically possible one. This value for sequence is converted to percentages, 100% being the highest level.

Contact
Prof. Ruslan Kalendar

Reference apply to all Web Tools update, if you use it in your work please cite.

Force-refresh this web page

Windows/Linux

In most browsers, pressing Ctrl+F5 will force the browser to retrieve the webpage.

Mac

For Safari users on OS X, hold down ⌘ Cmd and ⇧ Shift key and then press R.