PrimersList


analyzes different features of multiple primers simultaneously, the melting temperature calculation for standard and degenerate oligonucleotides, GC content, primer PCR efficiency; primers are analyzed for all primer secondary structures including G-quadruplexes detection, hairpins, self-dimers and cross-dimers in primer pairs; sequence linguistic complexity, molecular weight, the extiction coefficient, the optical density (OD);
the optimal temperature of annealing (Ta) calculation for all given primers.

PrimersList Web Start or

Write or paste your primer sequences to the input field (upper window). The analyzer accepts text and table format (can be copied from an Excel file, for example). Note: This analyzer requires at least 1 primer sequence in the input field.

  • A name is (not) required for each primer (eg. Seq1 agtcagtcagtcagtcagtc).
  • The name and sequence string can be separated with either space or tab, as long as the style is the same for all the primers.
  • Degenerate primer sequences are also accepted. Each letter represents a combination of one or several nucleotides: B=(C,G,T), D=(A,G,T), H=(A,C,T), K=(G,T), M=(A,C), N=(A,C,G,T), R=(A,G), S=(G,C), V=(A,C,G), W=(A,T), Y=(C,T). U=Uracil; I=Inosine; and LNA: dA=E, dC=F, dG=J, dT=L.

The results will appear instantly in the output fields (lower windows), and update automatically if you make changes to the sequences. The results can be copied and pasted to other programs (Word, Excel, etc.). The analyzer will give the following results:

  • Tm (°C)
  • CG content (%)
  • Length of the primers (nt)
  • Number of individual bases (A, T, C and G)
  • Extinction coefficient (l/(mol·cm))
  • Molecular weight (g/mol)
  • Amount / OD unit (nmol/OD260)
  • Mass (µg/OD260)
  • Primer-dimer estimation**







Contact
Dr. Ruslan Kalendar


Reference apply to all Web Tools update, if you use it in your work please cite:

Kalendar R, Khassenov B, Ramankulov Y, Samuilova O, Ivanov KI 2017. FastPCR: an in silico tool for fast primer and probe design and advanced sequence analysis. Genomics, 109: 312-319. DOI:10.1016/j.ygeno.2017.05.005

Kalendar R, Muterko A, Shamekova M, Zhambakin K 2017. In silico PCR tools a fast primer, probe and advanced searching. Methods in Molecular Biology, 1620: 1-31. DOI:10.1007/978-1-4939-7060-5_1

Kalendar R, Tselykh T, Khassenov B, Ramanculov EM 2017. Introduction on using the FastPCR software and the related Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis. Methods in Molecular Biology, 1620: 33-64. DOI:10.1007/978-1-4939-7060-5_2

Guedin A, Gros J, Alberti P, Mergny J. 2010. How long is too long? Effects of loop size on G-quadruplex stability. Nucleic Acids Res, 38(21):7858-7868.

Watkins NE, SantaLucia JJ 2005. Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes. Nucleic Acids Res, 33(19): 6258-6267.

McTigue, Patricia M, Peterson, Raymond J, and Kahn, Jason D 2004. Sequence-Dependent Thermodynamic Parameters for Locked Nucleic Acid (LNA)-DNA Duplex Formation. Biochemistry, 43:5388-5405.

SantaLucia J 1998. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. PNAS, 95:1460-1465.

Xia T, SantaLucia J Jr, Burkard ME, Kierzek R, Schroeder SJ, Jiao X, Cox C, Turner DH 1998. Thermodynamic parameters for an expanded nearest-neighbor model for formation of RNA duplexes with Watson-Crick base pairs. Biochemistry, 37(42):14719-35.