PrimerAnalyser

provides comprehensive analysis of sequence with standard and mixed bases, as well as DNA, RNA, methylated, locked and phosphorothioated bases; tool will calculate the physical properties of the sequence including length, CG content, melting temperature, molecular weight, the extiction coefficient, the optical density (OD), sequence linguistic complexity, primer PCR efficiency, self-dimers and G-quadruplexes detection.

• A name is not required for oligonucleotide (eg. agtcagtcagtcagtcagtc).
• Degenerate primer sequences are also accepted. Each letter represents a combination of one or several nucleotides: B=(C,G,T), D=(A,G,T), H=(A,C,T), K=(G,T), M=(A,C), N=(A,C,G,T), R=(A,G), S=(G,C), V=(A,C,G), W=(A,T), Y=(C,T). U=Uracil; I=Inosine; and LNA: dA=E, dC=F, dG=J, dT=L.
• Linguistic sequence complexity (LC%) is a measure of the 'vocabulary richness' of a genetic text based on counting the number of possible combinations of nucleotide combinations ("entropy" of the set of possibilities) to the theoretically possible one. This value for sequence is converted to percentages, 100% being the highest level.
• Melting temperature calculations are based on nearest neighbor thermodynamic parameters for standard and degenerate oligonucleotides, including LNA and other modifications. And provides a dilution and resuspension calculator for stocks.

The Analyzer provides the following results:

• Tm (°C)
• CG content (%)
• Sequence linguistic complexity (LC%)
• Length of the primers (nt)
• Number of individual bases (A, T, C and G)

• Extinction coefficient (l/(mol·cm))
• Molecular weight (g/mol)
• Amount/OD unit (nmol/OD260)
• Mass (µg/OD260)
• Primer-dimer estimation