FastPCR Quick PCR Commands Help


PCR

Element nameDescriptionFastPCR online Support
 /?Loading current options of PCR primers design:  /?
no
 -iPCRInverted PCR, example: > -iPCR

yes
  -npd
 -Fnpd
 -Rnpd
Exclude primers design, but external primers can be added with the -fp[] command:
> -npd

yes
 -pcrNoPCR primers design only, no PCR primer combinations reporting (is equivalent to "-npc0" command):
> -pcrNO

yes
 (N1-N2)specify the minimal and maximal size requested for the PCR product, N1 for shortest, N2 for the longest PCR product; (N1) or (N1-N1) is allowed:
> (400-500)

yes
 -pdN1-N2
-FpdN1-N2
-RpdN1-N2

 -pdN1-N2/N3
Primer Design to define position of the target DNA on initial N1 and final N2 position (N2>N1) in DNA sequence:
> -pd350-700

design PCR primers between coordinate N1 and N2 (N2>N1) for Forward or Reverse:
> -Fpd100-500 -Rpd1000-1200

User can specify the area in which to search for primers around the area (-pdN1-N2/N3), for example, interested area 400-500, and we want to pick up primers surrounding the site within 100 bases, whereas the primers for Forward will be between 300-400, and 500-600 for Reverse:
> -pd400-500/100
this command is equal to  -Fpd300-400 -Rpd500-600

generally: -pdN1-N2/N3 is equal to -Fpd(N1-N3)-N2 -RpdN2-(N2+N3)

yes
 -pdN1-e
-FpdN1-e
-RpdN1-e
Design PCR primers in area: from the end of sequence minus N bases design left or right PCR primers from the end of sequence minus N bases:
> -Fpd200-e
> -Rpd200-e
yes
 -excludeN1-N2
 -excludeN1-e
The Excluded Region List(s) denotes locations where primers and probe must not bind. Multiple excluded regions may be defined per sequence. This feature can be used to avoid unwanted regions (ex. intron, SNP etc). For example, if the excluded region is bases 500-1000 for the target selection need use the command:
> -exclude500-1000

An alternative way is to use two sign '/' for the start and end of such excluded region (possible multiple times):

>example1
[gtcccgagaacctgagtatgcatcacccggatcgcttcttcc/gggaggtgttggggg/ ctatctcggtgttttctgactgcttggcttccgcgagtcattgccatgctagcgta]
[attgcaataaccggagcgagatgatgcacc/ccccc/ccttgacaagcgccaataccacgcactattaagagtaaaaaaaa]

yes
  -pr[NNN/NNN]
 -Fpr[NNN/NNN]
 -Rpr[NNN/NNN]
External primer(s) for use in PCR analysis, at 5'->3', with a "/" to separate the primers, automatic detection of the location of the primer with mismatches;:

> -pr[attccattccgcgttcga/tcctacgttccgttacc]

pre-designed Forward and Reverse PCR primer: 
> -Fpr[attccattccgcgttcga/cgttacggtatttcttgc/cgttacggtatttcttgg] -Rpr[cgttacggtatttcttgc]

yes
 -npcN1Determine the maximum Number of Primers Combinations, for example 10 (-npc0 is equivalent to "-pcrNo" command):
> -npc10
yes
  -nprN1
 -FnprN1
 -RnprN1
Showing maximal Number of designed Primers per task:
> -npr10

yes
 -ptmsN1Synchronizing Tm for Primer Pair (±°C):
> -ptms10
yes
Instead of using these commands -FpdN1-N2, -RpdN1-N2 or -pdN1-N2, for individual targets selection for Forward or Reverse primers in a particular location, user can apply any multiple combinations of '[ ]' or '] [' inside the sequence(s).
Use of these brackets differs from software Primer3, for example:
 
1. The same location for both Forward and Reverse primers will be designed in the central [nnnnnnnnnn] part (only once '[ ]' is used):
 
...AAAAAAAAAA[nnnnnnnnnn]CCCCCCCC...
 
2. Different locations for Forward and Reverse primers; Forward (red) primers will be chosen inside [1nnnnnn] location and Reverse (blue) primers inside [2nnnnnn] location, (twice '[ ]'):
 
...AAAAAAAAAA[1nnnnnn]AAAAAAAA[2nnnnnn]AAAAA...
 
3. Design primers must flank the central ]nnnnnn[ ; Forward primers will be chosen from 1 to A] bases and Reverse primers will be chosen from [C base to the end of sequence:
 
...AAAAAAAAAA]nnnnnn[CCCCCCC...

4. Design primers with overlapping part [nnnnnn] for Forward and Reverse primers;
Forward primers will be chosen from [A to n] bases and Reverse primers will be chosen from [n base to C]:
 
    ———— Forward —————
   ↓                 ↓
...[AAAAAAAAAA[nnnnnn]CCCCCCC]...
              ↑              ↑
               ——— Reverse ———

Program allow to select up to 1000 independent PCR primers (probe) designing tasks for each sequences using multiple combinations of '[..]' and -FpdN1-N2, -RpdN1-N2 or -pdN1-N2 commands.

Multiplex PCR can be carried out simultaneously within a single sequence with multiple tasks as well as for different sequences or multiple tasks or both cases together.

All possible combinations of '[  ]' (Forward) with '[  ]' (Reverse) within the sequence(s):
1.  [        ]
2.     ]  [
3.  [  ]  [  ]
4.  [  [  ]  ]




Primers design options control

Element nameDescriptionFastPCR online Support
  -bst
 -Fbst
 -Rbst
design BeST PCR primers for current options design best left or right PCR primers:
> -bst

no
  -any
 -Fany
 -Rany
design ANY PCR primers:
> -any

no
  -lowcg
 -Flowcg
 -Rlowcg
design PCR primers for low CG% sequence:
> -lowcg

no
  -dfs
 -Fdfs
 -Rdfs
design PCR primers for difficult region:
> -dfs

no
  -protein
 -Fprotein
 -Rprotein
design PCR primers for degenerated sequences:
> -protein

no
  -lnN1-N2
 -FlnN1-N2
 -RlnN1-N2
 -PlnN1-N2
Minimal-Maximal length for Forward or (and) Reverse primers or Probe design:
> -FlN18-22 -RlN22-22
yes
  -tmN1-N2
 -FtmN1-N2
 -RtmN1-N2
 -PtmN1-N2
Minimal-Maximal Tm for Forward or (and) Reverse primers or Probe design:
> -Ftm40-50 -Rtm50-60

yes
  -3tmN1-N2
 -F3tmN1-N2
 -R3tmN1-N2
 -P3tmN1-N2
Minimal-Maximal Temperature of Melting for last 12 bases at the 3'-end of Forward or Reverse primers or Probe:
> -F3tm31-35 -R3tm35-45

yes
  -qN1
 -FqN1
 -RqN1
Minimal-Maximal Quality for Forward or (and) Reverse primers:
> -Fq5 –Rq90


yes
  -dmrN1
 -FdmrN1
 -RdmrN1
 -PdmrN1
The level of rigor detection primer dimer, where N1 from 0 to 5. Level 1 is the default and is the most stringent criterion, the value of 5 for insensitive detection. A value of 0 to ignore the detection of primer dimer:
> -dmr0


yes
  -opYes|No
 -FopYes|No
 -RopYes|No
Primers overlapping control: if type -FopNo, all forward primers will not overlap; -RopYes all reverse primers will overlap:
> -FopNo -RopYes

yes
 -ctYes|No
-FctYes|No
-RctYes|No
-PctYes|No
(Optional)(Copy Test) for PCR primers repetition test repetition test for Forward or Reverse PCR primes or Probe design:
> -FctYes -RctNo

yes
   -x3e
  -fx3e
 -Ffx3e
 -Rfx3e

  -fx5e
 -Ffx5e
 -Rfx5e
Design PCR primer for a specific sequence on the fixed 5' or 3' ends to selected sequence, for example, if user need to link all primers to 5'end of sequence, use -fx5e, program will show all primers with the same location but different length. The same situation is for a linkage the 3'end of primers to a certain location:

> -fx3e
yes
  -c3[NNN/NNN]
 -Fc3[NNN/NNN]
 -Rc3[NNN/NNN]

  -c5[NNN/NNN]
 -Fc5[NNN/NNN]
 -Rc5[NNN/NNN]

Certain sequence(s) in the direct or complementary (second c) orientation for Forward or Reverse primers (probes) 3' or 5'-ends nucleotide composition or an indication of a specific sequence location;
the program accept the universal degenerate DNA code (IUB/IUPAC), and minimum 2 bases in length and maximum for the primer length:

[NNN/NNN] - for any bases, example for Forward primers -c3[RRY] is equivalent to -c3[aat/gat/agt/ggt/aac/gac/agc/ggc]; accepted the sequences with different lengths:

> -c3[wss/wss/ssw]
> -c3[ACCC/TTCG]

yes
  -z3eNameEnzyme
 -Fz3eNameEnzyme
 -Rz3eNameEnzyme
Primers (probes) directly designed to the restriction enzyme site at 3' end.“NameEnzyme” is the restriction enzyme name:
example, this is as the alternative command: –c3YCATG^R is the same as –z3eXceI:

> -Fz3eXceI

Result: 3’end of all primers contains sequences: YCATGR
For not included enzymes in FastPCR database, this command will be ignored.
no
  -5e[NNN] or -5e[NNN/NNN]
 -F5e[NNN]
 -R5e[NNN
Primer 5'-End Tail(s): additional, not from current DNA sequence. which will be added to 5' of primers (probes) (any length):
> -F5e[CGACG] -R5e[TTTTTT]


yes
  -3e[NNN] or -3e[NNN/NNN]
 -F3e[NNN]
 -R3e[NNN]
 -P3e[NNN]
Primer 3'-End Tail(s): additional, not from current DNA sequence. which will be added to 3' of primers (probes) (any length):
> -F3e[GG] -R3e[CC]
yes
 -excludeIUPAC
 -nomxbpr
Avoidance of degenerate (mixed, ambiguous) IUPAC nucleotides within primer/probe sequences.no


Special cases

Element nameDescriptionFastPCR online Support
 -LampNLoop-mediated Isothermal Amplification (LAMP) primer design:
{-LAMP1 } - LAMP assay design without using Loop Primers
{-LAMP2 } - LAMP assay design with Loop Primers

{ -ln18-25 -tm55-57 -c3[sww sws wws wss www] }

>example1 -Lamp1
cctgcgatcgcacgcacgaagtaagggtattccatgcgtctgggtgggcacagtacaaaggggcaggattcgcct gaagatataccttgaatgtta

>example using Loop Primer: -Lamp2
cctgcgatcgcacgcacgaagtaagggtattccatgcgtctgggtgggcacagtacaaaggggcaggattcgcct gaagatataccttgaatgtta

yes
 -ASPCRAllele-specific polymerase chain reaction (AS-PCR): KASP™ (Kompetitive Allele Specific PCR) or PACE™ (PCR Allele Competitive Extension) based genotyping assay design for biallelic (or up to four variants) discrimination of single nucleotide polymorphisms (SNPs) and insertions and deletions (Indels) at specific loci.
In this example, the command (-P5e[gaaggtgaccaagttcatgct/gaaggtcggagtcaacggatt]) is indicated of adding of 2 variants of 5'-tail sequences for each allelic variant and the amplicon size is not more than 150 nucleotides (40-150):

{ -ASPCR -P5e[gaaggtgaccaagttcatgct/gaaggtcggagtcaacggatt] (40-150) }
>example1
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [C/G] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

>example2
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [S] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

Advanced example - 3 InDels variants:

> -ASPCR -P5e[gaaggtgaccaagttcatgct/gaaggtcggagtcaacggatt/gaaggtcggagtcaacggacc]

TAAGAGCTGAAGAGCTAGCTGGCTAGCTGATTAA [ATAT/CC/A] AGCTGCTAGACGTCGCAGTCGACACTGACGTCCTAGGACAAAGTCTCGTG

yes
-SNaPshot The SNaPshot® Multiplex System is a primer extension-based method for genotyping known SNP positions through the automated DNA analyzer invented by Applied Biosystems. Through its multiplexing capability, up to 10 SNPs can be analyzed in a single reaction by using unlabeled, user-defined primers.

{ -snapshot -pTm52-54 -pln16-35 -popyes }
>example1
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [W] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

>example2
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [S] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

no
-MLPA A Multiplex Ligation Assay (MLA) or a digital MLA (dMLA) - MLPA® Multiplex Ligation-dependent Probe Amplification is a technology designed to detect copy number changes (deletions and duplications) in genomic DNA invented by MRC Holland that allows detection of DNA copy number changes of up to 40 sequences in a single reaction. MLPA has a variety of applications including detection of mutations and single nucleotide polymorphisms, analysis of DNA methylation, relative mRNA quantification, chromosomal characterisation of cell lines and tissue samples, detection of gene copy number, detection of duplications and deletions and aneuploidy determination.

{ -mlpa -pTm62-65 -pln21-50 -P5e[GGGTTCCCTAAGGGTTGGA/TCTAGATTGGATCTTGCTGGCAC] }
>example1
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [A] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

>example2
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagc [CC] agctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

no
 -LUXpdN1-N2
-FLUXpd
-RLUXpd
LUX (Light Upon eXtension) primer design. LUX fluorogenic (self-quenched) Forward primers desig for quantitative PCR, between coordinate N1 and N2 for left or right sequence side. The design factors are the presence of either a C or G as the terminal 3′ nucleotide of the primer, the fluorophore being attached to the second or third base (T) from the 3′ end, the presence of one or more Gs within the 3 nt flanking the labeled nucleotide and, for hairpin primers, the existence of a 5′ tail that is complementary to the 3′ end of the primer. The 5′ tail forms a blunt-end hairpin at temperatures below its melting point. The stem of the hairpin primers have a ΔG ranging from –1.6 to –5.8 kcal/mol.

Example, design forward LUX primers:

> -Fluxpd
[ctccccagacctatgttgtaagtggtcatgatacatgactagggtagagagaggagtgtctgtcaaaaaaga][ctgcgtgccctgagcttagctaccggttgaggtatctgagggactaccagtaacagatccccaggaattagccagaaaaaa]

> -LUXpd100-200
cttagatcgacaggtctaagagctgaagagctagctattaaagtcgagcagctgctagacgtcgcagtcgacacagctagcctaggacaaagtctcgtg

no
-tiling[±N]Design of overlapping [<0] and non-overlapping [>0] DNA amplicons in a single-tube multiplex PCR for targeted next-generation sequencing (DNA-Based Molecular Tagging System):

-tiling[-120] is negative value of N, meaning overlapping amplicons at about 120 bp;
-tiling[20] value of N is positive (or 0) for non-overlapping amplicons.
no
 -TaqMan
 -MGB
 -Beacon
 -Scorpion
Beacon probe design both direction:
> -Beacon 
no
  -ssr/N
  -ssr
Design PCR primers to Simple sequence repeat (SSR) loci, the software automatically finds SSR loci and will design primers:
N is optional value for distance before (Forward primers) and after (Reverse primers) SSR loci:
> -ssr/200
yes






PCR set-up examples