PrimerDigital


PCR set-up examples

Primer design for performing LAMP (Loop-mediated Isothermal Amplification) amplification

The following is the main points of primer design.
{ -lamp1 -ln18-24 -tm52-54 }

  • Distance between primer regions. The distance between 5' end of F2 and B2 is considered to be 120-200 bp and the distance between F2 and F3 as well as B2 and B3 is 0-20bp. The distance for loop forming regions (5' of F2 to 3' of F1, 5' of B2 to 3' of B1) is 0-40bp.
  • Tm value for primer regions. About 52-54°C and 18-24 nt:
    • -ln18-24 -tm52-54
  • Secondary structure
    • Primers should be designed so as not to form secondary structures, 3'end sequence should not be AT rich or complementary to other primers.
Late PCR


Linear-After-The-Exponential (LATE)-PCR

The concentration-adjusted melting temperature (Tm) of the limiting primer (TmL) relative to that of the excess primer (TmX) affects both amplification efficiency and specificity during the exponential phase of LATE-PCR. The highest reaction efficiency and specificity were observed when TmL - TmX ≥5°C.
For example, it is necessary to select Forward and Reverse primers with a difference in Tm of about 12 degrees:
 -Ftm50-55 -Rtm64-68 -dTMs12

Late PCR


PCR primer design to Simple Sequence Repeat (SSR) loci (200 bp around SSR)

 -ssr/200

Late PCR

Prediction Ta (temperature of annealing) of PCR

also prediction PCR fragment(s) length for one or more existing primers (with -npd command) for current sequence:
{  -FPR[gcgaaaaccaagtgcttacctcg atactccctccgtccctaaa] -npd }

Ta calculation

The result is:
Ta calculation

How to make primer with adapter sequence (user defined) in either 5' or 3' or both end of the primer:
1) Select the adapter sequence you want to use
This can be A) at the 5' end of the final primer, such as sequence containing a restriction sequence for downstream handling of the PCR products or
B) at the 3' end of the final primer such as adapter for precise PCR amplification of a known sequence. User can make the 5' end of this primer also fixed such as restriction site or specific for annealing site for additional PCR primer.
C) The adapter sequence can also be designed at both 5' and 3' ends.
In all cases (A, B and C) the primers will be tested by the program against the whole template sequence provided by the user.

2A) The adapter at 5' end:
Type the command -5e, or -F5e (Forward) or -R5e (Reverse) after the name of the sequence and type the sequence of the adapter immediately after the command.

Example

-F5eCGACG or -R5eTTTTTT
If user want complementary sequence then add letter "c":

Example

-Fc5eCGACG - program convert to complement 5'-CGTCG (equal to -F5eCGTCG)

2B) The adapter at 3' end:
Type the command -3e, or -F3e (forward) or -R3e (reverse) after the name of the sequence and type the sequence of the adapter immediately after the command.

Example

-F3eGGTTC or -R3eCCTT
If user want complementary sequence then add letter "c":

Example

-Fc3eGGA
- program convert to complement 5'-TCC (equal to -F3eTCC)

2C) The adapter at both 5' and 3' ends at the same time:
Type both commands -3e and -5e after the name of the sequence and type the sequence of the adapter immediately after the commands.
Example for Forward primers:
> -F3eGG -F5eGG


Hint

user can also design the 5' or 3' end of the primer to behave as a specific template for secondary PCR amplification by using the random DNA generated by the program as a template sequence (see the "Tools" => "Generate Random DNA").
The primers created against the random DNA are unique and usually do not match to any sequence found in databases. This is why they are suitable to use in secondary PCR amplification reactions where false annealing sites are not desired. However, user may need to ensure this by blasting this random part of the adapter against relevant databases and/or in case of longer primer-adapter molecules fold them (by using mFOLD etc.) to screen out any primers showing any unwanted secondary structures.


Manual