FastPCR is a software package to aid molecular biologist, students, and other in the study, manipulation and design experiment. The logical structure of FastPCR is known below.
Three independent text editors (RTF) at different Tab: general, additional and results:
Two first text editors are equally reading any sequence formats, but general editor designed for working with all sequence(s); additional editor use for predesigned primer(s) or sequence(s).
Import sequences from a clipboard with keyboard (Shit-Insert or Ctrl-V) and right-click mouse displays a contextual menu. Tab View for choosing task:
The result will appear in status bar and press F5:
Standard Menu Toolbar
Find Window – use F3, is the quick way to find exact word in general editor.
Menu toolbar
Clean text at current open TAB editor (Ctrl-D)
Open file into general editor-
Open file into memory, sequence will not appear in TAB editor 
Save text as Rich Text (.RTF) or Excel (.XLS) formats from opened TAB.
-
For starting any job, need press F5 or from tool bar press
Quick sequence transformation
Tool for converting sequences to IUB/IUPAC FASTA format (Ctrl-F1);
Tool bar for converting the sequences to FASTA format with saving original sequence (alignment) (Ctrl-F2);
FastPCR program includes tools for the manipulation of DNA or protein sequences:
Reverse (e.g. acacacc become ccacaca) (Ctrl-F3)
Complement (e.g. acacacc become tgtgtgg) (Ctrl-F4)
Reverse-Complement transformation (e.g. acacacc become ggtgtgt) (Ctrl-F5)
DNA-to-protein translation in all the 6 reading frames; orientation, complementation of protein sequence, and protein-to-DNA translation (Ctrl-F6)
Tool for joining all sequences into a single sequence (Ctrl-F7)
Export data from opened Tab into Excel sheet (Ctrl-F8)- Names to Number List (Ctrl-F9) – tool for converting sequences to FASTA format with changing sequence’s name to number. Default is 1, to specify initial number, type in additional editor this number
- Tab-Table Format (Ctrl-F11) – tool for converting sequences to column format with Tab separator between names
- Blank-Table Format (Ctrl-F12) – tool for converting sequences to column format with space separator between names
In case the @ character at the beginning of the sequence name’s, the result – the sequence will be translated into complementary (for Ctrl-1 and Ctrl-2), or remains the original seqience (for other cases).
Selecting and extracting fragments tool for linear sequence. Using additional editor, you can specify region(s) for extracting from sequence(s). To select fragments needs to select a beginning and an end that will be the beginning and end of the produced fragment.
Example, type on sequence description:
> 1 100 300 550
acgacgcagcagcacgacagt…
Output result extraction: the sub-fragments between 1 and 100 and second between 300 and 550.
