Prepare for PCR analysis

Primer Design Options” is general for all given sequences, as background. For individual, selective options and task, sequences need convert to FASTA format with “>”, these options have a highest priority, and they are covering the general (background) options. All these command used optionally and only for advanced tasks. In generally, you can relax and forgot about it. Press F5 show what is FastPCR found in given sequences. The result file (Excel sheet, XML page or Text) contains a list of the best primers and compatible primer combinations. It shows the type of PCR, the left and right flanking regions for primer selection, and the annealing temperature. Each primer combination includes information for primer position and length, optimal melting temperature and product length.

PCR primers and probes design command lines

Any of these following commands must be written AFTER the sequence name or “>” (these commands are not case sensitive) and press Enter and the end of line. The commands can occupy any place in the command line.

PCR set-up examples


Example: PCR primer design to Simple Sequence Repeat (SSR) loci (200 bp around SSR):

> -ssr/200

Example: prediction Ta (temperature of annealing) of PCR and PCR fragment(s) length for one or more existing primers (with -npd command) for current sequence:

> -fpr[ggagagtagcttacctcgct cggtaaggttcttcatgc] -npd

LATE-PCR example: necessary to select forward and reverse primers with a difference in Tm of about 10 degrees:

> -Ftm50-55 -Rtm64-68 -pTMs10

How to make primer with adapter sequence (user defined) in either 5′ or 3′ or both end of the primer:


1) Select the adapter sequence you want to use
This can be
A) at the 5' end of the final primer, such as sequence containing a restriction sequence for downstream handling of the PCR products or
B) at the 3' end of the final primer such as adapter for precise PCR amplification of a known sequence. You can make the 5' end of this primer also fixed such as restriction site or specific for annealing site for additional PCR primer.
C) The adapter sequence can also be designed at both 5' and 3' ends.

In all cases (A, B and C) the primers will be tested by the program against the whole template sequence provided by the user.

2A) The adapter at 5' end:

Type the command -5e, or -F5e (Forward) or -R5e (Reverse) after the name of the sequence and type the sequence of the adapter immediately after the command.
Example:
> -F5eCGACG or -R5eTTTTTT
If you want complementary sequence then add letter "c":
Example:
> -Fc5eCGACG - program convert to complement 5'-CGTCG (equal to -F5eCGTCG)

2B) The adapter at 3' end:

Type the command -3e, or -F3e (forward) or -R3e (reverse) after the name of the sequence and type the sequence of the adapter immediately after the command.
Example:
> -F3eGGTTC or -R3eCCTT
If you want complementary sequence then add letter "c":
Example:
> -Fc3eGGA
- program convert to complement 5'-TCC (equal to -F3eTCC)

2C) The adapter at both 5' and 3' ends at the same time:

Type both commands -3e and -5e after the name of the sequence and type the sequence of the adapter immediately after the commands.
Example for Forward primers:
> -F3eGG -F5eGG

Hint: you can also design the 5' or 3' end of the primer to behave as a specific template for secondary PCR amplification by using the random DNA generated by the program as a template sequence (see the "Tools" => "Generate Random DNA").
The primers created against the random DNA are unique and usually do not match to any sequence found in databases. This is why
they are suitable to use in secondary PCR amplification reactions where false annealing sites are not desired. However, you may
need to ensure this by blasting this random part of the adapter against relevant databases and/or in case of longer primer-adapter
molecules fold them (by using mFOLD etc.) to screen out any primers showing any unwanted secondary structures.

Leave a Reply