FastPCR automatically generate results in Results Tab at tabulated format (ready for transferring to Excel sheet, press), output results is easy to save as .XLS or .RTF Text file, compatible for Excel or Open Office or copy-paste to clipboard:
Primers shown at tabulated format (ready for transferring to Excel sheet):
| PrimerID | Sequence(5′-3′) | Length (bp) |
Tm (°C) |
Tm 3′end(°C) |
CG(%) | Linguistic complexity (%) |
Quality (%) |
| >1 | |||||||
| 1F1_1_13-34 | aattgccccgcccaacacgggt | 22 | 66,5 | 47,6 | 63,6 | 85 | 70 |
| 1F2_1_39-59 | aggtgtgtgagcctcgactgt | 21 | 60,1 | 44,5 | 57,1 | 81 | 94 |
| 1F3_1_52-72 | tcgactgttcctcgccataag | 21 | 56,6 | 40,6 | 52,4 | 96 | 93 |
| 1F4_1_64-86 | cgccataagaaccctagtgcgga | 23 | 60,8 | 40,6 | 56,5 | 97 | 97 |
Primers ID (Identifiers) designed format:
PCR product output, each line contains compatible primer pair (Forward and Reverse primers):
| Forward PrimerID |
Sequence(5′-3′) | Tm(°C) | Primer Quality (%) |
Reverse PrimerID |
Sequence(5′-3′) | Tm(°C) | Primer Quality (%) |
PCR Fragment Size(bp) |
Topt (°C) |
| 1F1_1_13-34 | aattgccccgcccaacacgggt | 66,2 | 93 | 1R3_1_529-552 | gcatccggtttacaaggccgttg | 61,1 | 97 | 540 | 60,2 |
| 1F1_1_13-34 | aattgccccgcccaacacgggt | 66,2 | 93 | 1R4_1_506-529 | gttgaactgccgcgccgtcttac | 62,8 | 95 | 517 | 60,7 |
| 1F1_1_13-34 | aattgccccgcccaacacgggt | 66,2 | 93 | 1R8_1_401-424 | ggtcaggtgaagtggcatcctgc | 62,3 | 97 | 412 | 60,3 |
| 1F2_1_39-59 | aggtgtgtgagcctcgactgt | 59,7 | 97 | 1R1_1_571-591 | tatccgcagctcgttgcttc | 57,3 | 92 | 553 | 59,1 |
