FastPCR has powerful database search capabilities. To perform a databases search, press “Database” from menu bar:

Depending on the object type the appropriate database search dialog box appears allowing you to define search conditions and perform the actual search. Name dialog box appears: searching and getting accessions contains some words inside accession’s names:

The boxes are connected with logical AND, the search will accept accessions which simultaneously satisfy the conditions. The conditions are connected with logical OR, the conditions in that box are satisfied if at least one condition is satisfied. “Input searching string in sequence names” field is box giving key words to search for. The accessions that have any one of the key words shown in this box will be found by the search. Key words added with “separator”, like space character or any else. The clear the key Words box, press the “Clean” button.
For example, accessions in FASTA format (any formats are applicable) in use:
>gnl|trep|trep1000 dna transposon, mite, stowaway, “hades_be704509-1″; complete element
tacttcctccgtcccaaaataagtatctcaactttgtactggctttagtacaaaattatactaagcttaagacacttatttt
>gnl|trep|trep1001 dna transposon, mite, stowaway, “hades_be704981-1″; complete element
tacttcctccgttccaaaatagatgtcatctattttggnacggacggagta
>gnl|trep|trep1002 dna transposon, mite, stowaway, “hades_bf293216-1″; complete element
tactccctccgttctaaaataaatgattcaattttatactaactttagtataaagttgggtcatctattttggaacggaggg
>gnl|trep|trep1003 dna transposon, mite, stowaway, “hades_bf588685-1″; complete element
tactccctctgttccaaaatagatgactcaactttgtactatatttgggaacagagggagta
>gnl|trep|trep1004 dna transposon, mite, stowaway, “hades_bf628687-1″; complete element
Tacttcctccgtcccaaaataagtgatttaaaaatgactcagttttgtactaactttagtacaaaattgagtcacttatttt
All accessions found will be show contains searching string: ltr or mite (if any).
Sequence database search
Searching for similarity in sequences or identical accession names:
