The optimal annealing temperature (Ta) is the range of temperatures where efficiency of PCR amplification is maximal without non-specific products.
The most important values for estimating the Ta is the primer quality, the Tm of the primers and the length of PCR fragment.
Primers with high Tm´s (>60°C) can be used in PCRs with a wide Ta range compared to primers with low Tm´s (<50°C). The optimal annealing temperature for PCR is calculated directly as the value for the primer with the lowest Tm (Tmmin). However, PCR can work in temperatures up to 10 degrees higher than the Tm of the primer to favour primer target duplex formation, our empirical formula:
Ta = Tmmin + ln(s),
where s is length of PCR fragment.
In our experience, almost all high-quality primers designed by FastPCR in the default or «best» mode provide amplification at annealing temperatures from 68 to 72°C without loss of PCR efficiency, and show good amplification in varying PCR annealing temperatures and when using different DNA polymerases and buffers.
Example
Prediction Ta (temperature of annealing) of PCR and PCR fragment(s) length for one or more existing primers (using -npd command) for current sequence:
> -fpr[ggagagtagcttacctcgct cggtaaggttcttcatgc] -npd
Another option is determining the value of the optimal annealing temperature is to use virtual (in silico) PCR.
